Easy To Use Patents Search & Patent Lawyer Directory

At Patents you can conduct a Patent Search, File a Patent Application, find a Patent Attorney, or search available technology through our Patent Exchange. Patents are available using simple keyword or date criteria. If you are looking to hire a patent attorney, you've come to the right place. Protect your idea and hire a patent lawyer.

Searching:





Search by keyword, patent number, inventor, assignee, city or state:




Patent # Description
2016/0304887 Introducing or Inactivating Female Fertility in Filamentous Fungal Cells
The present invention relates to a female fertile variant strain of filamentous fungus derived from a female sterile parental strain which comprises at least...
2016/0304886 COMPOSITIONS AND METHOD FOR DESTABILIZING, ALTERING, AND DISPERSING BIOFILMS
The present disclosure relates to compositions and methods for destabilizing biofilms, altering biofilm 3D structure, and dispersing biofilms, in order to...
2016/0304885 Genetic Transformation of Bifidobacteria
The present invention concerns a method for genetically transforming a Bifidobacterium strain comprising a step of methylation of a shuttle vector in an E....
2016/0304884 Compositions and Methods for Expressing Nucleic Acid Sequences
Described herein is the development of a multi-plasmid system (Compatible Antibiotic-free Multi-Plasmid System, CAMPS) for the expression of one or more...
2016/0304883 ARTIFICIAL NUCLEIC ACID MOLECULES
The invention relates to an artificial nucleic acid molecule comprising at least one open reading frame and at least one 3'-untranslated region element (3'-UTR...
2016/0304882 METHOD FOR PROPAGATING ADENOVIRAL VECTORS ENCODING INHIBITORY GENE PRODUCTS
The invention provides a method of propagating an adenoviral vector. The method comprises (a) providing a cell comprising a cellular genome comprising a...
2016/0304881 DDR1 ANTAGONIST OR AN INHIBITOR OF DDR1 GENE EXPRESSION FOR USE IN THE PREVENTION OR TREATMENT OF CRESCENTIC...
The present invention relates to uses, methods and compositions for treating crescentic glomerulonephritis. More specifically, the present invention relates to...
2016/0304880 siRNA AND THEIR USE IN METHODS AND COMPOSITIONS FOR INHIBITING THE EXPRESSION OF THE ORAI1 GENE
The invention relates to si RNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the ORAI1 gene. The...
2016/0304879 Double-Stranded RNA Compounds to CASP2 and Uses Thereof
The present disclosure relates to methods of treating a patient suffering from or at risk of developing an ocular disease, disorder or injury, and includes...
2016/0304878 NUCLEIC ACID INDUCING RNA INTERFERENCE MODIFIED FOR PREVENTING OFF-TARGET, AND USE THEREOF
The present invention relates to an RNA interference-inducing nucleic acid and the use thereof, and more particularly to an RNA interference-inducing nucleic...
2016/0304877 COMPOUNDS AND METHODS FOR MODULATION OF DYSTROPHIA MYOTONICA-PROTEIN KINASE (DMPK) EXPRESSION
Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods,...
2016/0304876 Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field
The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological...
2016/0304875 METHODS FOR TREATMENT OF WOUND HEALING UTILIZING CHEMICALLY MODIFIED OLIGONUCLEOTIDES
The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and...
2016/0304874 HIGH TEMPERATURE SELECTION OF NUCLEOTIDE-SUPPORTED CARBOHYDRATE VACCINES AND RESULTING GLYCOSYLATED...
The invention relates to an oligonucleotide including one or more modified nucleoside bases having the structure -B-L-A wherein for each of the modified...
2016/0304873 Immunotherapy of Cancer
Immunogenic modulators and compositions comprising oligonucleotide agents capable of inhibiting suppression of immune response by reducing expression of one or...
2016/0304872 FRACTIONAL REGULATION OF TRANSCRIPTION
A method of controlling the number of cells in a population of cells having silenced transcription of a target nucleic acid as a function of time includes...
2016/0304871 COMPOSITIONS FOR MODULATING C9ORF72 EXPRESSION
Disclosed herein are compositions and methods for reducing expression of C9ORF72 mRNA and protein in an animal. Such methods are useful to treat, prevent,...
2016/0304870 METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF TRANSTHYRETIN (TTR) BY DOUBLE-STRANDED RNA
This invention relates to compounds, compositions, and methods useful for reducing transthyretin (TTR) target RNA and protein levels via use of dsRNAs, e.g.,...
2016/0304869 Materials and Methods for Treatment of Pulmonary Arterial Hypertension
The invention relates to the use of microRNA 96 and precursors and mimics thereof for the inhibition of vascular cell proliferation and/or vascular ...
2016/0304868 COMPOSITIONS OF ASYMMETRIC INTERFERING RNA AND USES THEREOF
The present invention provides asymmetrical duplex RNA molecules that are capable of effecting sequence-specific gene silencing. The RNA molecule comprises a...
2016/0304867 siRNA AND THEIR USE IN METHODS AND COMPOSITIONS FOR INHIBITING THE EXPRESSION OF THE FLAP GENE
The invention relates to si RNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the FLAP gene. The...
2016/0304866 Drug for Disease Caused by Expression of Periostin Except Eye Disease, and Use Thereof
The present invention is intended to provide a novel molecule that inhibits the expression of the periostin gene that is effective in treatment of diseases...
2016/0304865 TOOLS AND METHODS USING MIRNA 182, 96 AND/OR 183 FOR TREATING PATHOLOGIES
The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or...
2016/0304864 MEANS AND METHODS FOR COUNTERACTING MUSCLE DISORDERS
The invention provides means and methods for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy and/or Becker Muscular Dystrophy. Therapies...
2016/0304863 3'END CAPS FOR RNAi AGENTS FOR USE IN RNA INTERFERENCE
The disclosure relates to novel compounds and compositions comprising a RNAi agent comprising a novel compound as a 3' end cap. The disclosure also relates to...
2016/0304862 ANTIGEN-BINDING MOLECULES, THE ANTIGEN-BINDING ACTIVITY OF WHICH VARIES ACCORDING TO THE CONCENTRATION OF...
An objective of the present invention is to provide target tissue-specific antigen-binding molecules, antigen-binding molecules whose antigen-binding activity...
2016/0304861 SPATIAL MULTIPLEXING FOR MULTISIGNAL CELLULAR IMAGING
The invention, in some aspects, relates to methods, systems, and components of a high-content, single-cell resolution, spatial multiplex cell imaging system.
2016/0304860 POLYNUCLEOTIDE BARCODE GENERATION
The present disclosure provides compositions, methods, systems, and devices for polynucleotide processing. Such polynucleotide processing may be useful for a...
2016/0304859 METHODS FOR THE PRODUCTION OF LIBRARIES FOR DIRECTED EVOLUTION
Disclosed herein is an efficient method of generating a library of variants of a sequence of interest, such as may be used in directed evolution. In one...
2016/0304858 DIRECTED EVOLUTION OF MULTIVALENT GLYCOPEPTIDES THAT TIGHTLY BIND TO TARGET PROTEINS
The invention relates to a method for selecting a glycopolypeptide that binds to a target protein, the method including the steps of providing a pool of...
2016/0304857 METHOD OF RAPID ISOLATION OF APTAMER BEACONS
Methods and compositions are provided for rapidly identifying novel structure-switching aptamers.
2016/0304856 NOVEL PEPTIDES AND USES THEREOF
The present disclosure relates to novel peptides and their uses including, proline-rich peptides that are useful for displaying a protein of interest at the...
2016/0304855 COEXPRESSION OF CAS9 AND TREX2 FOR TARGETED MUTAGENESIS
A composition used in targeted mutagenesis is provided, which includes a first expression cassette comprising a nucleotide sequence which encodes a CAS9...
2016/0304854 MITOCHONDRIAL GENOME EDITING
Methods of preventing the transmission of a mitochondrial disease, disorder, or condition using mitochondria-targeted enzymes or mRNA encoding...
2016/0304853 POLYNUCLEOTIDE ENCODING PSICOSE EPIMERASE AND METHOD OF PRODUCING PSICOSE USING THE SAME
A psicose 3-epimerase, a polynucleotide encoding the enzyme, a recombinant vector carrying the polynucleotide, a recombinant cell harboring the recombinant...
2016/0304852 MUTANT POLYPEPTIDES AND USES THEREOF
The present disclosure provides novel polypeptides with 3-buten-2-ol dehydratase activity, polypeptides with catalytic activity in the conversion of...
2016/0304851 Factor IX Variants with Clotting Activity in Absence of Their Cofactor and/or With Increased F.IX Clotting...
The present invention relates to variants of factor IX (F.IX) or activated factor IX (F.IXa), wherein the variant is characterized in that it has clotting...
2016/0304850 Methods for obtaining positive transformants of a filamentous fungal host cell
The present invention relates to methods for obtaining positive transformants of a filamentous fungal host cell, comprising: transforming a tandem construct...
2016/0304849 IMPROVED BETA-GLUCOSIDASE ENZYMES FOR INCREASED BIOMASS SACCHARIFICATION
Described herein are beta-glucosidase enzymes that have improved beta-glucosidase activity compared to a control beta-glucosidase enzyme. The improved...
2016/0304848 ENZYME-COMPOSITION FOR HYDROLYZING BIOMASS
The present invention is directed to an enzyme-composition for hydrolyzing biomass containing comprising at least one cellulase, at least one hemicellulases...
2016/0304847 Methods For Enhancing The Degradation Or Conversion Of Cellulosic Material
The present invention relates to methods for degrading or converting a cellulosic material and for producing a substance from a cellulosic material.
2016/0304846 CAS VARIANTS FOR GENE EDITING
Some aspects of this disclosure provide strategies, systems, reagents, methods, and kits that are useful for the targeted editing of nucleic acids, including...
2016/0304845 NEW DNA CLEAVAGE ENZYME
There is provided an enzyme which has an activity of cleaving a phosphodiester bond of deoxyribonucleotide having a damaged base and deoxyribonucleotide...
2016/0304844 MUTANT RB69 DNA POLYMERASE
Provided herein are mutant DNA-dependent polymerases which are derived from, or otherwise related to, wild type RB69 DNA polymerase. These mutant polymerases...
2016/0304843 MUTANT TRANSAMINASES AS WELL AS METHODS AND USES RELATING THERETO
The present invention relates to a mutant transaminase with increased transaminase activity relative to the wild-type transaminase, a fusion protein comprising...
2016/0304842 COMPOSITIONS AND METHODS FOR EXPRESSION OF NITROGENASE IN PLANT CELLS
The disclosure provides nucleic acid constructs encoding novel chimeric peptides that are useful for nuclear and chloroplast expression of active nitrogenase...
2016/0304841 PROCESSES FOR PRODUCING POLYUNSATURATED FATTY ACIDS IN TRANSGENIC ORGANISMS
The present invention relates to polynucleotides from Ostreococcus lucimarinus which code for desaturases and elongases and which can be employed for the...
2016/0304840 Method for Producing Induced Pluripotent Stem Cells
Described herein is an inactivated viral particle comprising one or more transcription factor proteins packaged within the particle. A method for using the...
2016/0304839 METHOD FOR PRODUCING PSEUDOISLET
Provided is a method for producing a pseudoislet, which method comprises: seeding 1,500 to 5,000 pluripotent stem cells in a cell culture well to prepare an...
2016/0304838 METHOD OF INDUCING KIDNEY FROM PLURIPOTENT STEM CELLS
The purpose of the present invention is to provide a process or method that can be utilized when deriving a three-dimensional structure of a kidney from...
← Previous | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 | Next →

File A Patent Application

  • Protect your idea -- Don't let someone else file first. Learn more.

  • 3 Easy Steps -- Complete Form, application Review, and File. See our process.

  • Attorney Review -- Have your application reviewed by a Patent Attorney. See what's included.