Easy To Use Patents Search & Patent Lawyer Directory

At Patents you can conduct a Patent Search, File a Patent Application, find a Patent Attorney, or search available technology through our Patent Exchange. Patents are available using simple keyword or date criteria. If you are looking to hire a patent attorney, you've come to the right place. Protect your idea and hire a patent lawyer.


Search All Patents:



  This Patent May Be For Sale or Lease. Contact Us

  Is This Your Patent? Claim This Patent Now.



Register or Login To Download This Patent As A PDF




United States Patent Application 20180080032
Kind Code A1
ZHANG; Kechun ;   et al. March 22, 2018

BIOSYNTHETIC PATHWAYS AND METHODS

Abstract

This disclosure describes a recombinant microbial cells and methods of making and using such recombinant microbial cells. Generally, the recombinant cells may be modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control. In some embodiments, the TCA derivative can include 1,4-butanediol. In various embodiments, the microbial cell is a fungal cell or a bacterial cell. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.


Inventors: ZHANG; Kechun; (Roseville, MN) ; XIONG; Mingyong; (Manitowoc, WI)
Applicant:
Name City State Country Type

REGENTS OF THE UNIVERSITY OF MINNESOTA

Minneapolis

MN

US
Family ID: 1000003020017
Appl. No.: 15/830765
Filed: December 4, 2017


Related U.S. Patent Documents

Application NumberFiling DatePatent Number
14653118Jun 17, 2015
PCT/US2013/076118Dec 18, 2013
15830765
61821490May 9, 2013
61738752Dec 18, 2012

Current U.S. Class: 1/1
Current CPC Class: C12Y 402/01082 20130101; C12Y 401/01007 20130101; C12Y 402/00 20130101; C12Y 301/01068 20130101; C12Y 301/01 20130101; C12Y 102/01026 20130101; C12N 15/52 20130101; C12Y 101/01 20130101; C12N 9/0008 20130101; C12N 9/88 20130101; C12N 9/18 20130101; C12N 9/0006 20130101; C12P 7/18 20130101; C12Y 101/01001 20130101
International Class: C12N 15/52 20060101 C12N015/52; C12N 9/02 20060101 C12N009/02; C12N 9/88 20060101 C12N009/88; C12N 9/18 20060101 C12N009/18; C12N 9/04 20060101 C12N009/04; C12P 7/18 20060101 C12P007/18

Claims



1. A recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.

2-134. (canceled)
Description



CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Patent Application Ser. No. 61/738,752, filed Dec. 18, 2012 and U.S. Provisional Patent Application Ser. No. 61/821,490, filed May 9, 2013, each of which is incorporated herein by reference.

SUMMARY

[0002] This disclosure describes, in one aspect, a recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control. In some embodiments, the TCA derivative can include 1,4-butanediol. In various embodiments, the microbial cell is a fungal cell or a bacterial cell. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

[0003] In another aspect, this disclosure describes a method that generally includes incubating any embodiments of the recombinant cell summarized above in medium that includes a carbon source under conditions effective for the recombinant cell to produce a TCA derivative. In some embodiments, the TCA derivative can include 1,4-butanediol. In some embodiments, the carbon source can include xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline. In some embodiments, the increased biosynthesis of the TCA derivative can include an increase in pentose dehydrogenase activity, pentonolactonase activity, aldonic acid dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity. In other embodiments, the increased biosynthesis of the TCA derivative can include an increase in hexic acid dehydratase activity or 5-dehydro-4-deoxyglucarate dehydratase activity.

[0004] In another aspect, this disclosure describes a method that generally includes introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes conversion of a carbon source to a TCA derivative, wherein the at least one polypeptide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to TCA derivative. In some embodiments, the TCA derivative can include 1,4-butanediol. In some embodiments, the carbon source can include xylose.

[0005] The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.

BRIEF DESCRIPTION OF THE FIGURES

[0006] FIG. 1. The 1,4-butanediol synthetic pathway in E. coli. (A) The synthetic pathway for 1,4-butanediol from glucose and xylose. Abbreviations: G-6P, glucose-6-phosphate; F-6P, fructose-6-phosphate; DHAP, dihydroxyacetone phosphate; GAP, glyceraldehyde-3-phosphate. (B) Synthetic operon for protein overexpression to drive the xylose towards 2,5-dioxopentanoic acid (left), and then drive 2,5-dioxopentanoic acid towards to 1,4-butanediol (right).

[0007] FIG. 2. A, scheme of the organization of conserved genetic clusters involved in the pentose, hexaric acid, and hydroxyproline degradation. Analogous functions are indicated in the same degree of shading. Coding region sizes and distances are not to scale. Protein family numbers are displayed below each coding region according to Clusters of Orthologous Groups of proteins classification system. The coding regions indicated in white or gray encode the following proteins: araA, transcriptional regulator; araF-araH, 1-Ara ABC transporter (periplasmic 1-Ara binding protein, ATP-binding protein, permease); rrnAC3038, heat shock protein X; ycbE, glucarate/galactarate permease; ycbG, transcriptional regulator; PP1249, hydroxyproline permease. B, schematic representation of the convergence of catabolic pathways for pentoses, hexaric acids, and hydroxyproline at the level of 2,5-dioxopentanoate. Enzymatic activities are indicated by their EC number. Dashed lines indicate proposed spontaneous reactions.

[0008] FIG. 3. An engineered 1,4-butanediol synthetic pathway in E. coli.

[0009] FIG. 4. An exemplary engineered metabolic pathway from 2,5-dioxopentanoic acid to 1,4-butanediol.

[0010] FIG. 5. An exemplary engineered metabolic pathway from 2,5-dioxopentanoic acid to 1,4-butanediol.

[0011] FIG. 6. An exemplary engineered metabolic pathway from D-arabonose to 2,5-dioxopentanoic acid.

[0012] FIG. 7. An exemplary engineered metabolic pathway from D-xylose to 2,5-dioxopentanoic acid.

[0013] FIG. 8. An exemplary engineered metabolic pathway from L-arabinose to 2,5-dioxopentanoic acid.

[0014] FIG. 9. An exemplary engineered metabolic pathway from D-glucaric acid to 2,5-dioxopentanoic acid.

[0015] FIG. 10. An exemplary engineered metabolic pathway from D-galactaric acid to 2,5-dioxopentanoic acid.

[0016] FIG. 11. An exemplary engineered metabolic pathway from 4(R)-hydroxy-L-proline to 2,5-dioxopentanoic acid.

[0017] FIG. 12. A plasmid map of YEplac195-xylBCDX (13945 bp).

[0018] FIG. 13. A plasmid map of YEplac11-KivDyqhD (9687 bp).

[0019] FIG. 14. Gas chromatography data showing production of 1,4-butanediol by genetically engineered S. cerevisiae.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0020] This disclosure describes a novel full biosynthetic pathway to biosynthesize high-volume TCA derivatives such as succinate, amino acids, and 1,4-butanediol from xylose by an engineered microbe. The TCA cycle can lead to many commercially important biobased chemicals such as, for example, amino acids (e.g., glutamate, threonine and lysine) and organic acids (e.g., succinate, maleate and fumarate). Here we report the engineering of a shortcut metabolic pathway to TCA cycle. The process from xylose to TCA only involves five steps as compared to conventional published pathways that include more than 20 steps. Because our pathway includes fewer steps from xylose to the TCA cycle, our pathway can produce TCA derivatives with the production of less by-product and, therefore, achieve higher yields than conventional biosynthetic pathways.

[0021] We have selected the TCA derivative 1,4-butanediol as a model product to demonstrate the generality of our novel biosynthetic pathway. 1,4-butanediol is a major commodity chemical; 2.5 million tons of 1,4-butanediol are used per year to make, for example, plastics, polyesters, and spandex fibers. 1,4-butanediol also can react, for example, with dicarboxylic acids to yield polyesters, with diisocyanates to yield polyurethanes, and with phosgene to yield chloroformates. Because our pathway permits the biosynthesis of 1,4-butanediol from, for example, xylose in only six steps from xylose to 1,4-butanediol, 1,4-butanediol may be biosynthesized with less by-product being formed and, therefore, a higher yield. For example, our pathway can produce produce 1.0 g/L 1,4-butanediol from 20 g/L xylose.

[0022] 1,4-butanediol currently is manufactured from petroleum-based feedstocks such as acetylene, butane, propylene, and butadiene. Given the industrial importance of 1,4-butanediol as a chemical intermediate and the issues associated with petroleum feedstocks, alternative low-cost renewable biosynthetic routes from sugars have been sought. However, the highly reduced nature of 1,4-butanediol relative to carbohydrates has thwarted attempts thus far to develop effective pathways and organisms for direct production.

[0023] 1,4-butanediol has been reported to be synthesized from glucose and xylose by engineered E. coli in which the succinyl-CoA intermediate was converted into succinate semialdehyde, 4-hydroxybutyrate, 4-hydroxybutyryl-CoA, 4-hydroxybutyraldehyde, and 1,4-butanediol by multiple enzymes from various organisms. This process involves around 20 chemical steps that include the pentose phosphate pathway, glycolysis, the TCA cycle, and designed artificial downstream metabolic steps. In contrast, this disclosure describes a shortcut pathway that requires only six steps (FIG. 1A).

[0024] D-xylose is converted by Caulobacter crescentus sequentially to D-xylonolactone, D-xylonate (D-xylonoic acid), 2-keto-3-deoxy-xylonate (2-oxo-4(S),5-dihydroxy-pentanoic acid), then .alpha.-ketoglutaric semialdehyde (2,5-dioxopentanoic acid) by, respectively, xylose dehydrogenase (xylB), xylonolactonase (xylC), xylonate dehydrogenase (xylD), Kda dehydratase (xylX). We cloned the coding regions of these enzymes into a single plasmid (pBDO-1), which was then transformed into an E. coli host cell. The host cell was then further modified to include a second plasmid that included a decarboxylase and an alcohol dehydrogenase. The decarboxylase converts the .alpha.-ketoglutaric semialdehyde to succinaldehyde; the alcohol dehydrogenase reduces the succinaldehyde to 1,4-butanediol (FIG. 1A). In some embodiments, the second plasmid was identified as pBDO-3 and included the coding regions of benzoylformate decarboxylase BFD (Pseudomonas putida) and an alcohol dehydrogenase of yqhD (E. coli). In other embodiments, the second plasmid was identified as pBDO-4 and included the decarboxylase of KIVD (Lactococcus lactis) and alcohol dehydrogenase of yqhD (E. coli).

[0025] The E. coli host cell possesses an endogenous xylose metabolism pathway that includes xylA, yjhH and yagE. To improve the product yield from xylose to 1,4-butanediol, expression of these three coding regions were inhibited. The host cell strain SBDO-1 is based on E. coli BW25113 in which xylA, yjhH, and yagE are knocked out so that SBDO-1 cannot metabolize xylose. Strain SBDO-2, carrying plasmid pBDO-1, also cannot metabolize xylose.

[0026] The strain SBDO-3, which is based on SBDO-2 but carries plasmid pBDO-2 that expresses .alpha.-ketoglutaric semialdehyde dehydrogenase xylA, can consume xylose quickly. These results indicate that the endogenous xylose utilization pathway in E. coli was blocked fully by the .DELTA.xylA, .DELTA.yjhH, and .DELTA.yagE deletions in SBDO-1. Moreover, these results demonstrate that the C. crescentus enzymes function in E. coli. Consequently, xylose metabolism observed in SBDO-4 and SBDO-5 is attributable to the xylose pathway from C. crescentus that we engineered into the host cell. To produce 1,4-butanediol, plasmids pBDO-3 or pBDO-4, each of which expresses the same alcohol dehydrogenase but a different decarboxylase, were introduced into strain SBDO-2 strain. After two days of fermentation, strain SBDO-4 (carrying pBDO-3) produced 0.25 g/L 1,4-butanediol with 0.1 g/L 1,2,4-butanetriol (a by-product); strain SBDO-5 (carrying pBDP-4) produced 1.0 g/L 1,4-butanediol with 4.0 g/L 1,2,4-butanetriol. Thus, the kivD encoded on pBDO-4 and carried by strain SBDO-5 provides better yield of 1,4-butanediol than BFD. Other than 1,2,4-butanetriol, no other byproducts were detected in significant amounts in the fermentation broth, suggesting that our new 1,4-butanediol producing pathway has higher 1,4-butanediol yield as compared with the published pathway (Yim et al., 2011. Nat. Chem. Biol. 7:445-452).

[0027] Thus, in one aspect, the invention provides recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.

[0028] While described above in the context of an exemplary embodiment in which the TCA derivative is a 1,4-butanediol, the recombinant cells and methods described herein can provide TCA derivatives other than 1,4-butanediol. Exemplary alternative TCA derivatives include, for example, succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate, and products synthesizable from a product of the TCA cycle in one, two, three, four, or five enzymatic steps. In some of these embodiments, one or more enzymes involved in the synthesis of the TCA derivative may be heterologous to the host cell and, therefore, provided recombinantly. Exemplary TCA derivative products and exemplary enzymes involved in the synthesis of the exemplary TCA derivative products are listed in Table 1. For any embodiment in which the identified enzyme is not endogenous to a host cell, the enzyme may be introduced into the host cell to produce a recombinant cell as described herein.

TABLE-US-00001 TABLE 1 Exemplary enzymes, enzyme sources, native substrates, and TCA derivative products SEQ Encoding Accession No.: Native TCA derivative ID Common Name Organism gene GI No. Substrate product NO D-arabinose dehydrogenase alcohol Sulfolobus SSO1300 NP_342747.1; D-arabinose D-arabinonic 1 dehydrogenase solfataricus GI: 15898142 acid from D- (AraDH) arabinose D-arabinonate dehydratase arabinonate Sulfolobus SSO3124 NP_344435.1; D-arabinonic 2-oxo-4(S),5- 6 dehydratase (AraD) solfataricus GI: 15899830 acid dihydroxy- pentanoic acid 2-Keto-3-deoxy-D-arabinonate Dehydratase 2-keto-4- Sulfolobus SSO3118 NP_344431.1; 2-oxo-4(S),5- 2,5- 11 pentenoate solfataricus GI: 15899826 dihydroxy- dioxopentanoic hydratase (KdaD) pentanoic acid acid 2,5-dioxopentanoate dehydrogenase aldehyde Sulfolobus SSO3117 NP_344430.1; 2,5- 2-oxoglutaric 16 dehydrogenase solfataricus GI: 15899825 dioxopentanoic acid (DopDH) acid 2,5-dioxovalerate dehydrogenase 2,5-dioxovalerate Bacillus YcbD NP_388129.1; 2,5- 2-oxoglutaric 21 dehydrogenase subtilis GI: 16077316 dioxopentanoic acid (YcbD) acid D-xylose dehydrogenase D-Xylose Caulobacter CC0821 YP_002516237.1; D-xylose D-xylonolactone 26 dehydrogenase crescentus GI: 221233801 (XylB) D-xylonolactonase D-xylonolactonase Caulobacter CC0820 YP_002516236.1; D-xylonolactone D-xylonic acid 31 (XylC) crescentus GI: 221233800 D-xylonate dehydratase D-xylonate Caulobacter CC0819 NP_419636.1 D-xylonic acid 2-oxo-4(S),5- 36 dehydratase (XylD) crescentus GI: 16125072 dihydroxy- pentanoic acid 2-Keto-3-deoxy-D-arabinonate dehydratase 2-keto-4- Caulobacter CC0823 NP_419640.1; 2-oxo-4(S),5- 2,5- 41 pentenoate crescentus GI: 16125076 dihydroxy- dioxopentanoic hydratase (XylX) pentanoic acid acid L-arabinose dehydrogenase dehydrogenase Burkholderia BTH_II1629 YP_439823.1; L-arabinose L- 46 (AraE) thailandensis GI: 83716868 arabinonolactone E264 from L-arabinose L-arabinonolactonase L- Burkholderia BTH_II1625 YP_439819.1; L- L-arabinonic acid 51 arabinonolactonase thailandensis GI: 83717359 arabinonolactone (Aral) E264 L-arabinonate dehydiatase L-arabinonate Burkholderia BTH_II1632 YP_439826.1; L-arabinonic acid 2-oxo-4(R),5- 56 dehydratase (AraB) thailandensis GI: 83718062 dihydroxy- E264 pentanoic acid 2-Keto-3-deoxy-L-arabinonate Dehydratase dihydrodipicolinate Burkholderia BTH_II1630 YP_439824.1; 2-oxo-4(R),5- 2,5- 61 synthase (AraD) thailandensis GI: 83717217 dihydroxy- dioxopentanoic E264 pentanoic acid acid D-glucarate dehydratase D-glucarate Bacillus YcbF NP_388131.2; D-glucaric acid 4-deoxy-5-keto- 66 dehydratase subtilis GI: 255767063 D-glucaric acid (YcbF) D-galactarate dehydratase D-galactarate Bacillus YcbH NP_388133.2; D-galactaric acid 4-deoxy-5-keto- 71 dehydratase subtilis GI: 255767065 D-glucaric acid (YcbH) 5-dehydro-4-deoxyglucarate dehydratase 5-dehydro-4- Bacillus YcbC NP_388128.2; 4-deoxy-5-keto- 2,5- 76 deoxyglucarate subtilis GI: 255767061 D-glucaric acid dioxopentanoic dehydratase acid (YcbC) Amino acid transporter LysE Amino acid Pseudomonas PP_1248 NP_743408.1; 4(R)-hydroxy-L- 4(R)-hydroxy-D- 81 transporter LysE putida GI: 26987983 proline proline (HypE) PP_1245 Hypothetical Pseudomonas PP_1245 NP_743405.1; 4(R)-hydroxy-D- 2-carboxy-4(R)- 86 protein of PP_1245 putida GI: 26987980 proline hydroxy-pyrroline PP_1247 Hypothetical Pseudomonas PP_1247 NP_743407.1; 2-carboxy-4(R)- 2,5- 91 protein of PP_1247 putida GI: 26987982 hydroxy-pyrroline dioxopentanoic acid PP_1246 Hypothetical Pseudomonas PP_1246 NP_743406.1; 2,5- 2-oxoglutaric 93 protein of PP_1246 putida GI: 6987981 dioxopentanoic acid acid Alpha-ketolsoyalerate decarboxylase alpha- Lactococcus KivD YP_003353820.1; 2,5- Succinaldehyde 98 ketolsoyalerate lactis GI: 281491840 dioxopentanoic decarboxylase acid Alcohol dehydrogenase (YqhD) alcohol E.coli yqhD YP_001459806.1; Succinaldehyde 1,4-butanediol 103 dehydrogenase GI: 157162488

[0029] In addition to the enzymes listed in Table 1, homologs of the listed enzymes may be used. Thus, as an alternative to AraDH (SEQ ID NO:1), one may use, for example, any of the polypeptides depicted in SEQ ID NO:2-5; as an alternative to AraD (SEQ ID NO:6), one may use, for example, any of the polypeptides depicted in SEQ ID NO: 7-10; as an alternative to Kda (SEQ ID NO:11), one may use, for example, any of the polypeptides depicted in SEQ ID NO: 12-15; as an alternative to DopDH (SEQ ID NO:16), one may use, for example, any of the polypeptides depicted in SEQ ID NO:17-20; as an alternative to YcbD (SEQ ID NO:21), one may use, for example, any of the polypeptides depicted in SEQ ID NO:22-25; as an alternative to XylB (SEQ ID NO:26), one may use, for example, any of the polypeptides depicted in SEQ ID NO:27-30; as an alternative to XylC (SEQ ID NO:31), one may use, for example, any of the polypeptides depicted in SEQ ID NO:32-35; as an alternative to XylD (SEQ ID NO:36), one may use, for example, any of the polypeptides depicted in SEQ ID NO:37-40; as an alternative to XylX (SEQ ID NO:41), one may use, for example, any of the polypeptides depicted in SEQ ID NO:42-45; as an alternative to AraE (SEQ ID NO:46), one may use, for example, any of the polypeptides depicted in SEQ ID NO:47-50; as an alternative to AraI (SEQ ID NO:51), one may use, for example, any of the polypeptides depicted in SEQ ID NO:52-55; as an alternative to AraB (SEQ ID NO:56), one may use, for example, any of the polypeptides depicted in SEQ ID NO:57-60; as an alternative to AraD (SEQ ID NO:61), one may use, for example, any of the polypeptides depicted in SEQ ID NO:62-65; as an alternative to YcbF (SEQ ID NO:66), one may use, for example, any of the polypeptides depicted in SEQ ID NO:67-70; as an alternative to YcbH (SEQ ID NO:71), one may use, for example, any of the polypeptides depicted in SEQ ID NO:72-75; as an alternative to YcbC (SEQ ID NO:76), one may use, for example, any of the polypeptides depicted in SEQ ID NO:77-80; as an alternative to HypE (SEQ ID NO:81), one may use, for example, any of the polypeptides depicted in SEQ ID NO:82-85; as an alternative to PP_1245 (SEQ ID NO:86), one may use, for example, any of the polypeptides depicted in SEQ ID NO:87-90; as an alternative to PP_1247 (SEQ ID NO:91), one may use, for example, the polypeptide depicted in SEQ ID NO:92; as an alternative to PP_1246 (SEQ ID NO:93), one may use, for example, any of the polypeptides depicted in SEQ ID NO:94-97; as an alternative to alpha-ketoisovalerate decarboxylase (SEQ ID NO:98), one may use, for example, any of the polypeptides depicted in SEQ ID NO:99-102; as an alternative to YqhD (SEQ ID NO:103), one may use, for example, any of the polypeptides depicted in SEQ ID NO:104-107.

[0030] In some cases, the wild-type control may be unable to produce the TCA derivative and, therefore, an increase in the biosynthesis of a particular product may reflect any measurable biosynthesis of that product. In certain embodiments, an increase in the biosynthesis of a TCA derivative can include biosynthesis sufficient for a culture of the microbial cell to accumulate the TCA derivative to a predetermine concentration.

[0031] The predetermined concentration may be any predetermined concentration of the product suitable for a given application. Thus, a predetermined concentration may be, for example, a concentration of at least 0.1 g/L such as, for example, at least 0.25 g/L, at least 0.5 g/L, at least 1.0 g/L, at least 2.0 g/L, at least 3.0 g/L, at least 4.0 g/L, at least 5.0 g/L, at least 6.0 g/L, at least 7.0 g/L, at least 8.0 g/L, at least 9.0 g/L, at least 10 g/L, at least 20 g/L, at least 50 g/L, at least 100 g/L, or at least 200 g/L.

[0032] While described above in the context of an exemplary embodiment in which the host cell is E. coli, the recombinant cells described herein can be constructed, and the methods of making and using the recombinant cells can be performed, using any suitable host cell.

[0033] Thus, the recombinant cell can be, or be derived from, any suitable microbe including, for example, a prokaryotic microbe or a eukaryotic microbe. As used herein, the term "or derived from" in connection with a microbe simply allows for the "host cell" to possess one or more genetic modifications before being modified to exhibit the indicated increased biosynthetic activity. Thus, the term "recombinant cell" encompasses a "host cell" that may contain nucleic acid material from more than one species before being modified to exhibit the indicated biosynthetic activity.

[0034] In some embodiments, the host cell may be selected to possess one or more natural physiological activities. For example, the host cell may be photosynthetic (e.g., cyanobacteria) or may be cellulolytic (e.g., Clostridium cellulolyticum).

[0035] In some embodiments, the recombinant cell may be, or be derived from, a eukaryotic microbe such as, for example, a fungal cell. In some of these embodiments, the fungal cell may be, or be derived from, a member of the Saccharomycetaceae family such as, for example, Saccharomyces cerevisiae, Candida rugosa, or Candida albicans.

[0036] In other embodiments, the recombinant cell may be, or be derived from, a prokaryotic microbe such as, for example, a bacterium. In some of these embodiments, the bacterium may be a member of the phylum Protobacteria. Exemplary members of the phylum Protobacteria include, for example, members of the Enterobacteriaceae family (e.g., Escherichia coli) and, for example, members of the Pseudomonaceae family (e.g., Pseudomonas putida). In other cases, the bacterium may be a member of the phylum Firmicutes. Exemplary members of the phylum Firmicutes include, for example, members of the Bacillaceae family (e.g., Bacillus subtilis), members of the Clostridiaceae family (e.g., Clostridium cellulolyticum) and, for example, members of the Streptococcaceae family (e.g., Lactococcus lactis). In other cases, the bacterium may be a member of the phylum Cyanobacteria.

[0037] In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can include an increase in activity of one or more enzymes involved in the metabolism of the carbon source (e.g., xylose or arabinose). Such enzymes may be found in the proteome of microbes such as, for example, Sulfolobus solfataricus, Caulobacter crescentus, Burkholderia thailandensis, Haloarcula marismortui, Bacillus subtilis, and Pseudomonas putida. Exemplary enzymes, shown in the context of their native metabolic pathways, are shown in FIG. 2. So, for example, increased biosynthesis of the TCA derivative can include an increase in activity of one or more enzymes involved in the metabolism of D-xylose in Caulobacter crescentus such as, for example, xylose dehydrogenase (FIG. 2, CC0821) activity, xylonolactonase (FIG. 2, CC0819) activity, xylonate dehydrogenase (FIG. 2, CC0822) activity, and 2-keto-3-deoxyaldonic acid dehydratase (FIG. 2, CC0823) activity compared to the wild-type control.

[0038] In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can further include an increase in benzoylformate decarboxylase activity and an increase in alcohol dehydrogenase activity. In some of these embodiments, the benzoylformate decarboxylase can include BFD of Pseudomonas putida. In some of these embodiments, the alcohol dehydrogenase can include yqhD of E. coli.

[0039] In some embodiments, the increased biosynthesis of the TCA derivative compared to a wild-type control can further include an increase in decarboxylase activity and an increase in alcohol dehydrogenase activity. In some of these embodiments, the decarboxylase can include KIVD of Lactococcus lactis. In some of these embodiments, the alcohol dehydrogenase can include yqhD of E. coli. See, e.g., Example 2 and FIGS. 12-14.

[0040] In some embodiments, the recombinant cell can include an engineered metabolic pathway designed to permit the recombinant cell to increase its consumption of a particular carbon source compared to a wild-type control. Exemplary metabolic pathways are illustrated in, for example, FIG. 6 through FIG. 11. Accordingly, exemplary carbon sources include, for example, arabinose, xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline. In other embodiments, the recombinant cell may be designed to consume a uronic acid such as, for example, galacturonic acid and/or glucuronic acid as a carbon source. In such embodiments, a heterologous polynucleotide that encodes a uronate dehydrogenase enzyme may be introduced into the recombinant cell to confer to the recombinant cell the ability to convert uronic acid to aldonic acid. In still other embodiments, the recombinant cell can utilize a carbon source that includes, for example, glucose, cellulose, galacturonic acid, glucuronic acid, CO.sub.2, or glycerol. In some of these embodiments, the recombinant cell may be further modified to convert the carbon source (e.g., glucose) to one or more of the carbon sources (e.g., xylose and/or a hexaric acid such as, e.g., glucaric acid) that is an entry point to one or more of the engineered pathways described herein.

[0041] FIG. 6 shows an exemplary metabolic pathway that permits a recombinant cell to use D-arabinose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-arabinose into D-arabinolactone such as, for example, a pentose dehydrogenase. One example of a suitable pentose dehydrogenase includes AraDH from Sulfolobus solfataricus. The pentose dehydrogenase can provide catalytic conversion of D-arabinose into D-arabinolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0042] The exemplary metabolic pathway illustrated in FIG. 6 also includes an enzyme that can convert D-arabinonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. One example of a suitable aldonic acid dehydratase includes AraD from Sulfolobus solfataricus. The aldonic acid dehydratase can provide catalytic conversion of D-arabinonic acid into 2-oxo-zhS),5-dihydroxy-peritanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0043] The exemplary metabolic pathway illustrated in FIG. 6 also includes an enzyme that can convert 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. On example of a suitable 2-keto-3-deoxyaldonic add dehydratase includes KdaD from Sulfolobus solfataricus. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(S) 5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0044] FIG. 7 shows an exemplary metabolic pathway that permits a recombinant cell to use D-xylose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert. D-xylose to D-xylonolactone such as, for example, a pentose dehydrogenase. Exemplary suitable pentose dehydrogenases include XylB from Caulobacter crescentus or rmAC3034 from Haloarcula marismortui. The pentose dehydrogenase can provide catalytic conversion of D-xylose to D-xylonolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0045] The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert D-xylonolactone to D-xylonic acid such as, for example, a pentonolactonase. Exemplary suitable pentonolactonases include XylC from Caulobacter crescentus or rmAC3033 from Haloarcula marismortui. The pentonolactonase can provide catalytic conversion of D-xylonolactone to D-xylonic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0046] The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. Exemplary suitable aldonic acid dehydratases include XylD from Caulobacter crescentus or rrnAC3032 from Haloarcula marismortui. The aldonic acid dehydratase can provide catalytic conversion of D-xylonic acid into 2-oxo-4(S),5-dihydroxy-pentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0047] The exemplary metabolic pathway illustrated in FIG. 7 also includes an enzyme that can convert 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. Exemplary suitable 2-keto-3-deoxyaldonic acid dehydratases include XylX from Caulobacter crescentus or rrnAC3039 from Haloarcula marismortui. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0048] FIG. 8 shows an exemplary metabolic pathway that permits a recombinant cell to use L-arabinose as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert L-arabinose to L-arabinol actone such as, for example, a pentose dehydrogenase. One example of a suitable pentose dehydrogenase includes AraE from Burkholderia thailandensis. The pentose dehydrogenase can provide catalytic conversion of L-arabinose to L-arabinolactone that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0049] The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert L-arabinolactone to L-arabinonic acid such as, for example, a pentonolactonase. One example of a suitable pentonolactonase includes AraI from Burkhoideria thailandensis. The pentonolactonase can provide catalytic conversion of L-arabinolactone to L-arabinonic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0050] The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid such as, for example, an aldonic acid dehydratase. One example of a suitable aldonic acid dehydratase includes AraB from Burkholderia thailandensis. The aldonic acid dehydratase can provide catalytic conversion of L-arabinonic add to 2-oxo-4(R),5-dihydroxy-pentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0051] The exemplary metabolic pathway illustrated in FIG. 8 also includes an enzyme that can convert 2-oxo-4(1t),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes AraD from Burkholderia thailandensis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic add that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0052] FIG. 9 shows an exemplary metabolic pathway that permits a recombinant cell to use D-glucaric acid as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid such as, for example, an aldonic acid dehydratase. Suitable exemplary aldonic acid dehydratases include YcbF from Bacillus subtilis. The aldonic acid dehydratase can provide catalytic conversion of D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0053] The exemplary metabolic pathway illustrated in FIG. 9 also includes an enzyme that can convert 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes YcbC from Bacillus subtilis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0054] FIG. 10 shows an exemplary metabolic pathway that permits a recombinant cell to use D-galactaric acid as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid such as, for example, an aldonic acid dehydratase. Suitable exemplary aldonic acid dehydratases include YcbH from Bacillus subtilis. The aldonic acid dehydratase can provide catalytic conversion of D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0055] The exemplary metabolic pathway illustrated in FIG. 9 also includes an enzyme that can convert 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One example of a suitable 2-keto-3-deoxyaldonic acid dehydratase includes YcbC from Bacillus subtilis. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0056] FIG. 11 shows an exemplary metabolic pathway that permits a recombinant cell to use 4(R)-hydroxy-D-proline as a carbon source for the production of 2,5-dioxopentanoic acid. In this example, the recombinant cell can include an enzyme that can convert 4(R)-hydroxy-D-proline to 4(R)-hydroxy-D-proline. One suitable exemplary enzyme for this embodiment includes, amino acid transporter LysE (HypE) from Pseudomonas. The enzyme can provide catalytic conversion of 4(R)-hydroxy-D-proline to 4(R)-hydroxy-D-proline that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0057] The exemplary metabolic pathway illustrated in FIG. 11 also includes an enzyme that can convert 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-.delta.-pyrroline. One suitable exemplary enzyme for this embodiment includes, for example, HypOX from Psendomonas. The enzyme can provide catalytic conversion of 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-.delta.-pyrroline that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0058] The exemplary metabolic pathway illustrated in FIG. 11 also includes an enzyme that can convert 2-oxo-4(R)-5-aminopentanoic acid to 2,5-dioxopentanoic acid such as, for example, a 2-keto-3-deoxyaldonic acid dehydratase. One exemplary 2-keto-3-deoxyaldonic acid dehydratase includes PP 1247 from Pseucionionas. The 2-keto-3-deoxyaldonic acid dehydratase can provide catalytic conversion of 2-oxo-4(R)-5-aminopentanoic acid to 2,5-dioxopentanoic acid that is, for example, at least 110% greater than that exhibited by a wild-type control.

[0059] The recombinant cell can be engineered to convert the 2,5-dioxopentanoic acid to any desirable TCA derivative. In some embodiments, the recombinant cell can include an .alpha.-ketoglutaric semialdehyde dehydrogenase to shunt the 2,5-dioxopentanoic acid into the TCA cycle. In this manner, TCA cycle derivatives such as, for example, succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate may be produced.

[0060] In some embodiments, however, the recombinant cell may be further modified to possess a metabolic pathway for the conversion of 2,5-dioxopentanoic acid to 1,4-butanediol. Exemplary metabolic pathways are illustrated, for example, in FIG. 4 and FIG. 5. The exemplary pathway illustrated in FIG. 4 includes an enzyme that can convert 2,5-dioxopentonoic acid to succinaldehyde such as, for example, a 2-ketoacid decarboxylase or a 2-oxoglutarate decarboxylase. Suitable exemplary enzymes include, for example, Kivd, BFD, and IPDC. The exemplary pathway illustrated in FIG. 4 also includes an enzyme that can convert succinaldehyde to 1,4-butanediol such as, for example, an alcohol dehydrogenase. Suitable exemplary alcohol dehydrogenases include YqhD, ADH6, YjgB, and YahK.

[0061] The exemplary pathway illustrated in FIG. 5 includes an enzyme that can convert 2,5-dioxopentonoic acid to 2-keto-5-hydroxy-pentonate such as, for example, an alcohol dehydrogenase. Here again, suitable exemplary alcohol dehydrogenases include, for example, YqhD, ADH6, YjgB, and YahK. The exemplary pathway illustrated in FIG. 5 includes an enzyme that can convert 2-keto-5-hydroxy-pentonate to 4-hydroxy-1-butyraldehyde such as, for example, a 2-ketoacid decarboxylase or a 2-oxoglutarate decarboxylase. Suitable exemplary enzymes include, for example, Kivd, BFD, and IPDC. The exemplary pathway illustrated in FIG. 5 includes conversion of 4-hydroxy-1-butyraldehyde into 1,4-butanediol. This conversion may be catalyzed by an alcohol dehydrogenase such as, for example, YqhD, ADH6, YjgB, and YahK. For the metabolic pathway illustrated in FIG. 5, therefore, the recombinant cell can include one or more alcohol dehydrogenases.

[0062] In some embodiments, the host cell can include one or more genetic modifications to reduce endogenous metabolism of the carbon source so that metabolism of the carbon source is directed toward the production of the TCA derivative. For example, in embodiments in which the carbon source is xylose and the host cell is E. coli, the host cell can include one or more modifications to decrease endogenous metabolism of xylose. In the case of E. coli, such modifications can include for example, a decrease in .alpha.-ketoglutaric semialdehyde dehydrogenase activity, aldolase activity, and/or 2-keto-3-deoxy gluconate aldolase activity. Such modifications can include modifications to coding regions of, or regulatory regions that control expression of, xylA, yjhH, and/or yagE. Such modifications can include, for example, a deletion of a sufficient amount of one or more coding regions that the enzymatic activity is reduced.

[0063] As used herein, the terms "activity" with regard to particular enzyme refers to the ability of a polypeptide, regardless of its common name or native function, to catalyze the conversion of the enzyme's substrate to a product, regardless of whether the "activity" as less than, equal to, or greater than the native activity of the identified enzyme. Methods for measuring the biosynthetic activities of cells are routine and well known to those of ordinary skill in the art.

[0064] As used herein, an increase in catalytic activity can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide can be, for example, at least 110%, at least 125%, at least 150%, at least 175%, at least 200% (two-fold), at least 250%, at least 300% (three-fold), at least 400% (four-fold), at least 500% (five-fold), at least 600% (six-fold), at least 700% (seven-fold), at least 800% (eight-fold), at least 900% (nine-fold), at least 1000% (10-fold), at least 2000% (20-fold), at least 3000% (30-fold), at least 4000% (40-fold), at least 5000% (50-fold), at least 6000% (60-fold), at least 7000% (70-fold), at least 8000% (80-fold), at least 9000% (90-fold), at least 10,000% (100-fold), or at least 100,000% (1000-fold) of the activity of an appropriate wild-type control.

[0065] Alternatively, an increase in catalytic activity may be expressed as at an increase in k.sub.cat such as, for example, at least a two-fold increase, at least a three-fold increase, at least a four-fold increase, at least a five-fold increase, at least a six-fold increase, at least a seven-fold increase, at least an eight-fold increase, at least a nine-fold increase, at least a 10-fold increase, at least a 15-fold increase, or at least a 20-fold increase in the k.sub.cat value of the enzymatic conversion.

[0066] An increase in catalytic activity also may be expressed in terms of a decrease in K.sub.m such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a seven-fold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the K.sub.m value of the enzymatic conversion.

[0067] A decrease in catalytic activity can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide can be, for example, no more than 95%, no more than 90%, no more than 85%, no more than 80%, no more than 75%, no more than 70%, no more than 65%, no more than 60%, no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1% of the activity, or 0% of the activity of a suitable wild-type control.

[0068] Alternatively, a decrease in catalytic activity can be expressed as an appropriate change in a catalytic constant. For example, a decrease in catalytic activity may be expressed as at a decrease in k.sub.cat such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a seven-fold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the k.sub.cat value of the enzymatic conversion.

[0069] A decrease in catalytic activity also may be expressed in terms of an increase in K.sub.m such as, for example, an increase in K.sub.m of at least two-fold, at least three-fold, at least four-fold, at least five-fold, at least six-fold, at least seven-fold, at least an eight-fold, at least nine-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, at least 40-fold, at least 45-fold, at least 50-fold, at least 75-fold, at least 100-fold, at least 150-fold, at least 200-fold, at least 230-fold, at least 250-fold, at least 300-fold, at least 350-fold, or at least 400-fold.

[0070] Thus, in another aspect, we describe herein methods for biosynthesis of a TCA derivative. Generally, the methods includes incubating a recombinant cell as described herein in medium that includes a carbon source under conditions effective for the recombinant cell to produce the TCA derivative. The carbon source can include, for example, saccharides (e.g., xylose, arabinose, glucose, cellulose), a uronic acid (e.g., galacturonic acid or glucuronic acid), CO.sub.2, glycerol, or a native substrate of an enzyme that is part of the engineered metabolic pathway. Exemplary native substrates of exemplary enzymes are shown in Table 1 and include, for example, glucaric acid, galactaric acid, hydroxyproline, arabinonic acid, 2-oxo-4(S),5-dihydroxy-pentanoic acid, 2-oxo-4(R),5-dihydroxy-pentanoic acid, 2,5-dioxopentanoic acid, xylonolactone, xylonic acid, arabinonolactone, 4-deoxy-5-keto-D-glucaric acid, 4(R)-hydroxy-L-proline, 4(R)-hydroxy-D-proline, 2-carboxy-4(R)-hydroxy-pyrroline, 2,5-dioxopentanoic acid, succinaldehyde.

[0071] In yet another aspect, we describe herein methods for introducing a heterologous polynucleotide into cell so that the host cell exhibits an increased ability to convert a carbon source to a TCA derivative. The heterologous polynucleotide can encode a polypeptide operably linked to a promoter so that modified cell catalyzes conversion of the carbon source to the TCA derivative. In some of these embodiments, the carbon source can include xylose. The host cells for such methods can include, for example, any of the microbial species identified above with regard to the recombinant cells described herein.

[0072] In some embodiments, the heterologous polynucleotide may be inserted into a vector. A vector is a replicating polynucleotide such as, for example, a plasmid, phage, or cosmid, to which another polynucleotide may be inserted so as to bring about the replication of the inserted polynucleotide. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989). A vector can permit, for example, further cloning--i.e., a cloning vector--or expression of the polypeptide encoded by the coding region--i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, or artificial chromosome vectors. In one embodiment, the vector is a plasmid. Selection of a vector can depend upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like.

[0073] An expression vector optionally includes regulatory sequences operably linked to the coding region. The polynucleotides described herein are not limited by the use of any particular promoter, and a wide variety of promoters are known. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3' direction) coding region. The promoter used can be a constitutive or an inducible promoter. It can be, but need not be, heterologous with respect to the host cell. Exemplary promoters include, for example, trp, tac, and T7.

[0074] "Coding sequence" or "coding region" refers to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences, expresses the encoded polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5' end and a translation stop codon at its 3' end. As used herein, the term "polypeptide" refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term "polypeptide" also includes molecules that contain more than one polypeptide joined by disulfide bonds, ionic bonds, or hydrophobic interactions, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, and protein are all included within the definition of polypeptide and these terms are used interchangeably. The term "polypeptide" does not connote a specific length of a polymer of amino acids, nor does it imply or distinguish whether the polypeptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring.

[0075] "Regulatory sequence" refers to a nucleotide sequence that regulates expression of a coding region to which it is operably linked. Nonlimiting examples of regulatory sequences include, for example, promoters, transcription initiation sites, translation start sites, translation stop sites, and terminators. "Operably linked" refers to a juxtaposition wherein the components are in a relationship permitting them to function in their intended manner. A regulatory sequence is "operably linked" to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.

[0076] As used in the preceding description, the term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements; the term "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims; unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0077] In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.

[0078] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

[0079] The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

EXAMPLES

Example 1

Bacterial Strains and Plasmids

[0080] All the primers were ordered from Eurofins MWG Operon and are listed in Table 1. The E. coli strains used in this study are listed in Table 2, which were all derived from E. coli K-12 strain BW25113.

TABLE-US-00002 TABLE 2 Strains, plasmids and primers used in this study Name Relevant genotype Reference Strains BW25113 rrnB.sub.T14 .DELTA.lacZ.sub.WJ16 hsdR514 .DELTA.araBAD.sub.AH33 .DELTA.rhaBAD.sub.LD78 A SBDO-1 BW25113 .DELTA.xylA .DELTA.yjhH .DELTA.yagE This work SBDO-2 SBDO-1 + pBDO-1 This work SBDO-3 SBDO-1 + pBDO-1 and pBDO-2 This work SBDO-4 SBDO-1 + pBDO-1 and pBDO-3 This work SBDO-5 SBDO-1 + pBDO-1 and pBDO-4 This work Plasmids pIBA7 ColE1 ori, Amp.sup.R, P.sub.LlacO.sub.1::kivD padA B pBDO-1 p15A ori, Kan.sup.R, P.sub.LlacO.sub.1::xylBCDX This work pBDO-2 ColE1 ori, Amp.sup.R, P.sub.LlacO.sub.1::xylA This work pBDO-3 ColE1 ori, Amp.sup.R, P.sub.LlacO.sub.1::BFD-yqhD This work pBDO-4 ColE1 ori, Amp.sup.R, P.sub.LlacO.sub.1::kivD-yqhD This work SEQ ID Primers NO: xylBAcc-F GGGCCCggtaccatgtcctcagccatctatcccagcct 108 xylBHinNheBa- GGGCCCGCTCAGCAAGCTTGCTAGCggatcctTaacgccagccggcgtcgatccagt 109 R xylCBamHI-F GGGCCCggatccAGGAGAAATTAACTatgaccgctcaagtcacttgcgtatg 110 xylCHindNhe- GGGCCCAAGCTTgctagcttagacaaggcggacctcatgctggg 111 R xylDNheI-F GGGCCCgctagcAGGAGAAATTAACTatgaggtccgccttgtctaaccgcac 112 xylDHind-R GGGCCCaagctttTagtggttgtggcggggcagcttgg 113 xylXHind-F GGGCCCaagcttAGGAGAAATTAACTAtggtttgtcggcggcttctagcatg 114 xylXBIpRem-R gcgcagctggcgttgttgtccttggccttTctgagcagcagggccgaacgaccttcgaa 115 XylXBIpI-R GGGCCCGCTCAGCttagaggaggccgcggccggccaggt 116 pZEkivD-F actgaccgaattcattaaagaggagaaaggtaccatgtatacagtaggagattacctatt 117 kivD-R ttatgatttattttgttcagcaaata 118 YqhDkivD-F ctgaacaaaataaatcataaAGGAGAAATTAACTATGAACAACTTTAATCTGCACACCCC 119 BFDpZE-F actgaccgaattcattaaagaggagaaaggtaccatggcttcggtacacggcaccacata 120 BFD-R tTacttcaccgggcttacggtgctta 121 CC0822Acc-F GGGCCCggtaccatgaccgacaccctgcgccattacat 122 CC0822Xba-R GGGCCCtctagattacgaccacgagtaggaggttttgg 123 A. Datsenko et al., 2000 Proc. Natl. Acad. Sci. U.S.A. 97: 6640-5. B. Zhang et al., 2011 ChemSusChem 4: 1068-1070.

[0081] All cloning procedures were carried out in the E. coli strain XL10-gold (Stratagene, Agilent Technologies, Santa Clara, Calif.). To build the plasmid pBDO-1, the coding regions of xylB, xylC, xylD, and xy/X were amplified by PCR with oligos of xylBAcc-F and xylBHinNheBa-R, xylCBamHI-F and xylCHindNhe-R, xylDNheI-F and xylDHind-R, xylXHind-F and xylXBlpRem-R, using genomic DNA of Caulobacter crescentus strain as template, and then these four coding regions of xylB, xylC, xylD, and xy/X were inserted into the corresponding restriction sites of pZA vector after digestion.

[0082] To make the plasmid pBDO-2, the coding region of xylA was PCR amplified by oligos of CC0822Acc-F and CC0822Xba-R using genomic DNA of C. crescentus strain as template, and then this coding region was inserted into the site between Acc65I and XbaI of vector pZE after digestion.

[0083] To construct the plasmids pBDO-3 and pBDO-4, four coding regions of BFD (using Pseudomonas putida genomic DNA as template), yqhD-1 (using E. coli genomic DNA as template), KIVD (from Lactococcus lactis, using plasmid pIBA7 as template) and yqhD-2 (using E. coli genomic DNA as template), were PCR amplified with oligos of BFDpZE-F and BFD-R, yqhDBFD-F and yqhDpZE-R, pZEkivD-F and kivD-R, yqhDkivD-F and yqhDpZE-R, and then pBDO-3 and pBDO-4 were completed by Gibson cloning method (Gibson et al., 2009. Nat. Meth. 6:343-345). P1 phages of xylA, yjhH and yagE and were obtained from the Keio collection (Baba et al., 2006 Mol. Syst. Biol. 2:10.1038). The phages were used to transfect the BW25113 strain to construct triple knockout strains. All the knockout strains were then transformed with pCP20 plasmid to remove the kanamycin marker. The correct knockouts were verified by PCR.

Cell Cultivation and Shake Flask Fermentation

[0084] Unless otherwise stated, cells were grown in test tubes at 37.degree. C. in 2X YT rich medium (16 g/L Bacto-tryptone, 10 g/L yeast extract, and 5 g/L NaCl) supplemented with 100 mg/L ampicillin and 50 mg/L kanamycin. 200 .mu.L of overnight cultures incubated in 2X YT medium were transferred into 5 mL M9 minimal medium supplemented with 5 g/L yeast extract, 5 g/L glucose, 40 g/L xylose, 100 mg/L ampicillin, and 50 mg/L kanamycin in 125 mL conical flasks. Isopropyl-.beta.-D-thiogalactoside (IPTG) was added at a concentration of 0.1 mM to induce protein expression. The fermentation broth was buffered by the presence of 0.5 g CaCO.sub.3.

Metabolite Analysis and Dry Cell Weight Determination

[0085] Fermentation products were analyzed using an Agilent 1260 Infinity HPLC equipped with an Aminex HPX 87H column (Bio-Rad Laboratories, Inc., Hercules, Calif.) and a refractive-index detector. The mobile phase was 5 mM H.sub.2SO.sub.4 with a flow rate 0.6 mL/min. The column temperature and detection temperature were 35.degree. C. and 50.degree. C., respectively. Cell dry weight was determined by filtering 5 mL culture through a 0.45 .mu.m glass fiber filter (Pall Life Sciences, Ann Arbor, Mich.). After removal of medium, the filter was washed with 15 mL of MilliQ water (EMD Millipore Corp., Billerica, Mass.), dried in an oven and then weighed. Cell dry weight was determined in triplicate.

Example 2

[0086] To produce 1,4-butanediol from xylose in yeast, one artificial synthetic pathway was introduced into the wild type Saccharomyces cerevisiae strain W303. To generate the artificial pathway we cloned a polynucleotide that encodes enzymes that convert xylose into 2,5-dioxopentanoic acid into the host yeast cell. We also cloned a polynucleotide that encoded enzymes that convert 2,5-dioxopentanoic acid into 1,4-butanediol. These enzymes were cloned into plasmids YEplac195-xylBCDX and YEplac112-KivdDyqhD as described in more detail below.

[0087] The transformed yeast were grown under fermentation conditions as described in more detail below for two day. After the fermentation, 1,4-butanediol was accumulated to a concentration of 20 mg/L. (FIG. 14).

Plasmid Construction in the Yeast 1,4-butanediol Synthetic Pathway

[0088] The construction of plasmid YEplac195-xylBCDX was finished by Gibson assembly. All of the primers are listed in Table 3.

[0089] The coding region for HXT7p was PCR amplified with the primer pair Hxt7p195-1F and Hxt7pXylB-R, using S. cerevisiae W303 genomic DNA as a template. Similarly, the PGK1p coding region was PCR amplified with the primer pair PGK1Phxt7t-F and PGK1PxylC-R; the ADH1p coding region was PCR amplified with the primer pair ADH1Ppgk1t-F and ADH1PxylD-R; the PDC1p coding region was PCR amplified with the primer pair PDC1PADH1T-F and PDC1PxylX-R; the HXT7t coding region was PCR amplified with the primer pair Hxt7tXylB-F and Hxt7tPGK1P-R; the PGK1t coding region was PCR amplified with the primer pair PGK1tXylC-F and PGK1tADH1p-R; the ADH1t coding region was PCR amplified with the primer pair ADH1TxylD-F and ADH1TPDC1P-R; and the PDC1t coding region was PCR amplified with primer pairs PDC1TxylX-F and PDC1T195-R, each by using S. cerevisiae W303 genomic DNA as template.

[0090] Caulobacter crescentus xylB coding region was PCR amplified with primer pair xylBhxt7p-F and xylBhxt7t-R using C. crescentus genomic DNA as template. Similarly, the xylC coding region was PCR amplified with primer pair xylCPGK1P-F and xylCPGK1t-R; the xylD coding region was PCR amplified with primer pair xylDADH1P-F/xylDADH1T-R; and the xylX coding region was PCR amplified with primer pair xylXPDC1P-F/xylXPDC1T-R; each using C. crescentus genomic DNA as template.

[0091] The combined fragment of HXT7p-xylB-HXT7t was amplified by overlapping PCR with the primer pair Hxt7p195-1F and Hxt7tPGK1P-R using the HXT7p/xylB/HXT7t DNA as a PCR template. The combined fragment PGK1p-xylC-PGK1t was amplified by overlapping PCR with the primer pair PGK1Phxt7t-F and PGK1tADH1p-R using the PGK1p/xylC/PGK1t DNA as a PCR template. The combined fragment ADH1p-xylD-ADH1t was amplified by overlapping PCR with the primer pair ADH1Ppgk1t-F and ADH1TPDC1P-R using the fragment ADH1p/xylD/ADH1t DNA as a PCR template. The combined fragment PDC1p-xylX-PDC1t was amplified by overlapping PCR with the primer pair PDC1PADH1T-F and PDC1T195-R using the PDC1p/xylX/PDC1t DNA as a PCR template.

[0092] The vector fragment YEp195v was amplified with primer pair 195HindIII-2F and 195EcoRI-2R by using YEplac195 as template. The fragments of YEp195v, HXT7p-xylB-HXT7t, PGK1p-xylC-PGK1t, ADH1p-xylD-ADH1t, and PDC1p-xylX-PDC1t were assembled by Gibson method to form the plasmid of YEplac195-xylBCDX (FIG. 12).

[0093] To build the plasmid of YEplac112-KivD-yqhD, the fragments of HXT7P2, HXT7T2, PGK1P2 and PGK1T2 were PCR amplified using S. cerevisiae W303 genmic DNA as a template. The HXT7P2 fragment was PCR amplified using the primer pair Hxt7p195-1F and HXT7PkivD-R; the HXT7T2 fragment was PCR amplified using the primer pair HXT7TKIVD-F and HXT7TPGK1P-R; the PGK1P2 fragment was PCR amplified using the primer pair PGK1PHXT7T-F/PGK1PyqhD-R; and the PGK1T2 fragment was PCR amplified using the primer pair PGK1TyqhD-F and PGK1T112-R.

[0094] The KIVD coding region from Lactococcus lactis was amplified with the primer pair KIVDHXT7P-F and KIVDHXT7T-R using L. lactis genomic DNA as template. The E. coli YqhD coding region was amplified with the primer pair yqhDPGK1P-F and yqhDPGK1T-R using E. coli genomic DNA as template.

[0095] The vector fragment YEp112v was amplified with primer pair 195HindIII-2F and 195EcoRI-2R by using YEplac112 as template. The fragments of YEp112v, HXT7P2, KIVD, HXT7T2, PGK1P2, yqhD and PGK1T2 were assembled by Gibson method to generate the plasmid of YEplac112-KivDyqhD. (FIG. 13).

TABLE-US-00003 TABLE 3 The used primers in this study SEQ ID Primer NO: 195HindIII-2F attgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgccaagctt 124 Hxt7p195-1F cagctatgaccatgattacgccaagcttGGTACCtcgtaggaacaatttcgggcccctgc 125 Hxt7pXylB-R cttcaggctgggatagatggctgaggacattttttgattaaaattaaaaaaactttttgt 126 XylBhxt7p-F acaaaaagtttttttaattttaatcaaaaaatgtcctcagccatctatcccagcctgaag 127 XylBhxt7t-R tgatcatgaattaataaaagtgttcgcaaatTaacgccagccggcgtcgatccagtattc 128 Hxt7tXylB-F gaatactggatcgacgccggctggcgttAatttgcgaacacttttattaattcatgatca 129 Hxt7tPGK1P-R actcacgagtaattcttgcaaatgcctCCTAGGagacactttttgaagcgggatacagaa 130 PGK1Phxt7t-F ttctgtatcccgcttcaaaaagtgtctCCTAGGaggcatttgcaagaattactcgtgagt 131 PGK1PxylC-R atcccatacgcaagtgacttgagcggtcattgttttatatttgttgtaaaaagtagataa 132 xylCPGK1P-F ttatctactttttacaacaaatataaaacaatgaccgctcaagtcacttgcgtatgggat 133 XylCPGK1t-R attgatctatcgatttcaattcaattcaatttagacaaggcggacctcatgctggggttg 134 PGK1tXy1C-F caaccccagcatgaggtccgccttgtctaaattgaattgaattgaaatcgatagatcaat 135 PGK1tADH1p-R ccgatgtatgggtttggttgccagaaGCtgagcttggagcaggaagaatacactatactg 136 ADH1Ppgk1t-F cagtatagtgtattcttcctgctccaagctcaGCttctggcaaccaaacccatacatcgg 137 ADH1PxylD-R gggcgtgcggttagacaaggcggacctcattgtatatgagatagttgattgtatgcttgg 138 xylDADH1P-F ccaagcatacaatcaactatctcatatacaatgaggtccgccttgtctaaccgcacgccc 139 xylDADH1T-R aataaaaatcataaatcataagaaattcgctTagtggttgtggcggggcagcttggccgc 140 ADH1TxylD-F gcggccaagctgccccgccacaaccactAagcgaatttcttatgatttatgatttttatt 141 ADH1TPDC1P-R gaaggtatgggtgcagtgtgcttatctACTAGTtgtggaagaacgattacaacaggtgtt 142 PDC1PADH1T-F aacacctgttgtaatcgttcttccacaACTAGTagataagcacactgcacccataccttc 143 PDC1PxylX-R ggtccatgctagaagccgccgacaaaccaTtttgattgatttgactgtgttattttgcgt 144 xylXPDC1P-F acgcaaaataacacagtcaaatcaatcaaaAtggtttgtcggcggcttctagcatggacc 145 xylXPDC1T-R actttaactaataattagagattaaatcgcttagaggaggccgcggccggccaggttgcg 146 PDC1TxylX-F cgcaacctggccggccgcggcctcctctaagcgatttaatctctaattattagttaaagt 147 PDC1T195-R acgttgtaaaacgacggccagtgaattcTCTAGAgcttgtcttgagcaattgcagagtcg 148 195EcoRI-2R agttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattc 149 HXT7PkivD-R ctaataggtaatctcctactgtatacatGGATCCtttttgattaaaattaaaaaaacttt 150 KIVDHXT7P-F aaagtttttttaattttaatcaaaaaGGATCCatgtatacagtaggagattacctattag 151 KIVDHXT7T-R tcatgaattaataaaagtgttcgcaaaGGTACCttatgatttattttgttcagcaaatag 152 HXT7TKIVD-F ctatttgctgaacaaaataaatcataaGGTACCtttgcgaacacttttattaattcatga 153 HXT7TPGK1P-R cttactcacgagtaattcttgcaaatgcctagacactttttgaagcgggatacagaaaaa 154 PGK1PHXT7T-F tttttctgtatcccgcttcaaaaagtgtctaggcatttgcaagaattactcgtgagtaag 155 PGK1PyqhD-R TGGGGTGTGCAGATTAAAGTTGTTCATTCTAGAtgttttatatttgttgtaaaaagtaga 156 yqhDPGK1P-F tctactttttacaacaaatataaaacaTCTAGAATGAACAACTTTAATCTGCACACCCCA 157 yqhDPGK1T-R gatctatcgatttcaattcaattcaatCTCGAGTTAGCGGGCGGCTTCGTATATACGGCG 158 PGK1TyqhD-F CGCCGTATATACGAAGCCGCCCGCTAACTCGAGattgaattgaattgaaatcgatagatc 159 PGK1T181-R gtcacgacgttgtaaaacgacggccagtgaattctgagcttggagcaggaagaatacact 160

1,4-butanediol Fermentation by Yeast in Shake Flask

[0096] The W303 yeast strain carrying plasmids of YEplac195-xylBCDX and YEplac112-KivDyqhD was cultured overnight in the Complete Minimal medium without uracil and tryptophan supplements at 30.degree. C. with shaking at 200 rpm. The yeast cells were harvested and washed in the next day, and then inoculated into 10 mL fresh medium identical to the overnight culture medium except that it further contained 20 g/L xylose. The shake flask was then sealed with parafilm, and cultured for two days at 30.degree. C. with shaking at 200 rpm. The fermentation broth was analyzed by gas chromatography to measure the amount of 1,4-butanediol. Results are shown in FIG. 14.

Exemplary Embodiments

[0097] Embodiment 1. A recombinant microbial cell modified to exhibit increased biosynthesis of a TCA derivative compared to a wild-type control.

[0098] Embodiment 2. The recombinant cell of Embodiment 1 wherein the TCA derivative comprises 1,4-butanediol.

[0099] Embodiment 3. The recombinant microbial cell any preceding Embodiment wherein the microbial cell is a fungal cell.

[0100] Embodiment 4. The recombinant cell of Embodiment 3 wherein the fungal cell is a member of the Saccharomycetaceae family.

[0101] Embodiment 5. The recombinant cell of Embodiment 3 wherein the fungal cell is Saccharomyces cerevisiae, Candida rugosa, or Candida albicans.

[0102] Embodiment 6. The recombinant cell of Embodiment 1 or Embodiment 2 wherein the microbial cell is a bacterial cell.

[0103] Embodiment 7. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Protobacteria.

[0104] Embodiment 8. The recombinant cell of Embodiment 7 wherein the bacterial cell is a member of the Enterobacteriaceae family.

[0105] Embodiment 9. The recombinant cell of Embodiment 8 wherein the bacterial cell is Escherichia coli.

[0106] Embodiment 10. The recombinant cell of Embodiment 7 wherein the bacterial cell is a member of the Pseudomonaceae family.

[0107] Embodiment 11. The recombinant cell of Embodiment 10 wherein the bacterial cell is Pseudomonas putida.

[0108] Embodiment 12. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Firmicutes.

[0109] Embodiment 13. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Bacillaceae family.

[0110] Embodiment 14. The recombinant cell of Embodiment 13 wherein the bacterial cell is Bacillus subtilis.

[0111] Embodiment 15. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Streptococcaceae family.

[0112] Embodiment 16. The recombinant cell of Embodiment 15 wherein the bacterial cell is Lactococcus lactis.

[0113] Embodiment 17. The recombinant cell of Embodiment 12 wherein the bacterial cell is a member of the Clostridiaceae family.

[0114] Embodiment 18. The recombinant cell of Embodiment 17 wherein the bacterial cell is Clostridium cellulolyticum.

[0115] Embodiment 19. The recombinant cell of Embodiment 6 wherein the bacterial cell is a member of the phylum Cyanobacteria.

[0116] Embodiment 20. The recombinant cell of any preceding Embodiment wherein the microbial cell is photosynthetic.

[0117] Embodiment 21. The recombinant cell of any preceding Embodiment wherein the microbial cell is cellulolytic.

[0118] Embodiment 22. The recombinant cell of any preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises an increase in xylose dehydrogenase activity, xylonolactonase activity, xylonate dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

[0119] Embodiment 23. The recombinant cell of Embodiment 22 wherein the increased biosynthesis of the TCA derivative further comprises an increase in benzoylformate decarboxylase activity and an increase in alcohol dehydrogenase activity.

[0120] Embodiment 24. The recombinant cell of Embodiment 23 wherein the benzoylformate decarboxylase comprises BFD of Pseudomonas putida.

[0121] Embodiment 25. The recombinant cell of Embodiment 23 wherein the alcohol dehydrogenase comprises yqhD of E. coli.

[0122] Embodiment 26. The recombinant cell of Embodiment 22 wherein the increased biosynthesis of the TCA derivative further comprises an increase in decarboxylase activity and an increase in alcohol dehydrogenase activity.

[0123] Embodiment 27. The recombinant cell of Embodiment 26 wherein the decarboxylase comprises KIVD of Lactococcus lactis.

[0124] Embodiment 28. The recombinant cell of Embodiment 26 wherein the alcohol dehydrogenase comprises yqhD of E. coli.

[0125] Embodiment 29. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in .alpha.-ketoglutaric semialdehyde dehydrogenase activity.

[0126] Embodiment 30. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in aldolase activity.

[0127] Embodiment 31. The recombinant cell of preceding Embodiment wherein the increased biosynthesis of the TCA derivative comprises a decrease in 2-keto-3-deoxy gluconate aldolase activity.

[0128] Embodiment 32. The recombinant cell of any preceding Embodiment comprising an engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol.

[0129] Embodiment 33. The recombinant cell of Embodiment 32 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde.

[0130] Embodiment 34. The recombinant cell of Embodiment 33 wherein the enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde comprises a 2-ketoacid decareboxylase or a 2-oxoglutarate decarboxylase.

[0131] Embodiment 35. The recombinant cell of Embodiment 33 or 34 wherein the enzyme that converts 2,5-dioxopentonoic acid into succinaldehyde comprises KIVD, BFD, or IPDC.

[0132] Embodiment 36. The recombinant cell of any one of Embodiments 32-35 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts succinaldehyde to 1,4-butanediol.

[0133] Embodiment 37. The recombinant cell of Embodiment 36 wherein the enzyme that converts succinaldehyde to 1,4-butanediol comprises an alcohol dehydrogenase.

[0134] Embodiment 38. The recombinant cell of Embodiment 36 or Embodiment 37 wherein the enzyme that converts succinaldehyde to 1,4-butanediol comprises YqhD, ADH6, YjgB, or YahK.

[0135] Embodiment 39. The recombinant cell of Embodiment 32 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid.

[0136] Embodiment 40. The recombinant cell of Embodiment 39 wherein the enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid comprises an alcohol dehydrogenase.

[0137] Embodiment 41. The recombinant cell of Embodiment 39 or Embodiment 40 wherein the enzyme that converts 2,5-dioxopentonoic acid into 2-keto-5-hydroxy-pentanoic acid comprises YqhD, ADH6, YjgB, or YahK.

[0138] Embodiment 42. The recombinant cell of any one of Embodiments 39-41 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde.

[0139] Embodiment 43. The recombinant cell of Embodiment 42 wherein the enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde comprises a 2-ketoacid decareboxylase or a 2-oxoglutarate decarboxylase.

[0140] Embodiment 44. The recombainant cell of Embodiment 42 or Embodiment 43 wherein the enzyme that converts 2-keto-5-hydroxy-pentanoic acid to 4-hydroxy-1-butyraldehyde comprises Kivd, BFD, or IPDC.

[0141] Embodiment 45. The recombinant cell of any one of Embodiments 42-44 wherein the engineered metabolic pathway for converting 2,5-dioxopentanoic acid to 1,4-butanediol comprises an enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol.

[0142] Embodiment 46. The recombinant cell of Embodiment 45 wherein the enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol comprises an alcohol dehydrogenase.

[0143] Embodiment 47. The recombinant cell of Embodiment 45 or Embodiment 46 wherein the enzyme that converts 4-hydroxy-1-butyraldehyde to 1,4-butanediol comprises YqhD, ADH6, YjgB, or YahK.

[0144] Embodiment 48. The recombinant cell of any preceding Embodiment comprising an engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid.

[0145] Embodiment 49. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-arabinose into D-arabinolactone.

[0146] Embodiment 50. The recombinant cell of Embodiment 49 wherein the enzyme that can convert D-arabinose into D-arabinolactone comprises a pentose dehydrogenase.

[0147] Embodiment 51. The recombinant cell of Embodiment 49 or Embodiment 50 wherein the enzyme that can convert D-arabinose into D-arabinonolactone comprises AraDH.

[0148] Embodiment 52. The recombinant cell of any one of Embodiments 49-51 wherein the recombinant cell exhibits conversion of D-arabinose into D-arabinonolactone at a level at least 110% of a wild-type control cell.

[0149] Embodiment 53. The recombinant cell of any one of Embodiments 49-52 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid.

[0150] Embodiment 54. The recombinant cell of Embodiment 53 wherein the enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.

[0151] Embodiment 55. The recombinant cell of Embodiment 53 or Embodiment 54 wherein the enzyme that converts D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid comprises AraD.

[0152] Embodiment 56. The recombinant cell of any one of Embodiments 53-55 wherein the recombinant cell exhibits conversion of D-arabononic acid to 2-oxo-4(s),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control cell.

[0153] Embodiment 57. The recombinant cell of any one of Embodiments 49-56 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid.

[0154] Embodiment 58. The recombinant cell of Embodiment 57 wherein the enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

[0155] Embodiment 59. The recombinant cell of Embodiment 57 or Embodiment 58 wherein the enzyme that converts 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises KdaD.

[0156] Embodiment 60. The recombinant cell of any one of Embodiments 57-59 wherein the recombinant cell exhibits conversion of 2-oxo-4(s),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control cell.

[0157] Embodiment 61. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylose to D-xylonolactone.

[0158] Embodiment 62. The recombinant cell of Embodiment 61 wherein the enzyme that converts D-xylose to D-xylonolactone comprises a pentose dehydrogenase.

[0159] Embodiment 63. The recombinant cell of Embodiment 61 or Embodiment 62 wherein enzyme that converts D-xylose to D-xylonolactone comprises XylB or rrnAC3034.

[0160] Embodiment 64. The recombinant cell of any one of Embodiments 61-63 wherein the recombinant cell exhibits conversion of D-xylose to D-xylonolactone at a level at least 110% of a wild-type control.

[0161] Embodiment 65. The recombinant cell of any one of Embodiments 61-64 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylonolactone to D-xylonic acid.

[0162] Embodiment 66. The recombinant cell of Embodiment 65 wherein the enzyme that converts D-xylonolactone to D-xylonic acid comprises a pentonolactonase.

[0163] Embodiment 67. The recombinant cell of Embodiment 65 or Embodiment 66 wherein the enzyme that converts D-xylonolactone to D-xylonic acid comprises XylC or rrnAC3033.

[0164] Embodiment 68. The recombinant cell of any one of Embodiments 65-67 wherein the recombinant cell exhibits conversion of D-xylonolactone to D-xylonic acid at a level at least 110% of a wild-type control.

[0165] Embodiment 69. The recombinant cell of any one of Embodiments 61-68 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid.

[0166] Embodiment 70. The recombinant cell of Embodiment 69 wherein the enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.

[0167] Embodiment 71. The recombinant cell of Embodiment 69 or Embodiment 70 wherein the enzyme that converts D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid comprises XylD or rrnAC3032.

[0168] Embodiment 72. The recombinant cell of any one of Embodiments 69-71 wherein the recombinant cell exhibits conversion of D-xylonic acid to 2-oxo-4(S),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control.

[0169] Embodiment 73. The recombinant cell of any one of Embodiments 61-72 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid.

[0170] Embodiment 74. The recombinant cell of Embodiment 73 wherein the enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

[0171] Embodiment 75. The recombinant cell of Embodiment 73 or Embodiment 74 wherein the enzyme that converts 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid comprises XylX or rrnAC3039.

[0172] Embodiment 76. The recombinant cell of any one of Embodiments 73-75 wherein the recombinant cell exhibits conversion of 2-oxo-4(S),5-dihydroxy-pentanoic acid to 2,5-dioxopenatnoic acid at a level at least 110% of a wild-type control.

[0173] Embodiment 77. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinose to L-arabinolactone.

[0174] Embodiment 78. The recombinant cell of Embodiment 77 wherein the enzyme that converts L-arabinose to L-arabinolactone comprises a pentose dehydrogenase.

[0175] Embodiment 79. The recombinant cell of Embodiment 77 or Embodiment 78 wherein the enzyme that converts L-arabinose to L-arabinolactone comprises AraE.

[0176] Embodiment 80. The recombinant cell of any one of Embodiments 77-79 wherein the recombinant cell exhibits conversion of L-arabinose to L-arabinolactone at a level at least 110% of a wild-type control.

[0177] Embodiment 81. The recombinant cell of any one of Embodiments 77-80 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinolactone to L-arabinonic acid.

[0178] Embodiment 82. The recombinant cell of Embodiment 81 wherein the enzyme that converts L-arabinolactone to L-arabinonic acid comprises a pentonolactonase.

[0179] Embodiment 83. The recombinant cell of Embodiment 81 or Embodiment 82 wherein the enzyme that converts L-arabinolactone to L-arabinonic acid comprises AraI.

[0180] Embodiment 84. The recombinant cell of any one of Embodiments 81-83 wherein the recombinant cell exhibits conversion of L-arabinolactone to L-arabinonic acid at a level at least 110% of a wild-type control.

[0181] Embodiment 85. The recombinant cell of any one of Embodiments 77-84 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid.

[0182] Embodiment 86. The recombinant cell of Embodiment 85 wherein the enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid comprises an aldonic acid dehydratase.

[0183] Embodiment 87. The recombinant cell of Embodiment 85 or Embodiment 86 wherein the enzyme that converts L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid comprises AraB.

[0184] Embodiment 88. The recombinant cell of any one of Embodiments 81-87 wherein the recombinant cell exhibits conversion of L-arabinonic acid to 2-oxo-4(R),5-dihydroxy-pentanoic acid at a level at least 110% of a wild-type control.

[0185] Embodiment 89. The recombinant cell of any one of Embodiments 77-88 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid.

[0186] Embodiment 90. The recombinant cell of Embodiments 89 wherein the enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

[0187] Embodiment 91. The recombinant cell of Embodiments 89 wherein the enzyme that converts 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid comprises AraD.

[0188] Embodiment 92. The recombinant cell of any one of Embodiments 89-90 wherein the recombinant cell exhibits conversion of 2-oxo-4(R),5-dihydroxy-pentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control.

[0189] Embodiment 93. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid.

[0190] Embodiment 94. The recombinant cell of Embodiment 93 wherein the enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid comprises an aldonic acid dehydratase.

[0191] Embodiment 95. The recombinant cell of Embodiment 93 or Embodiment 94 wherein the enzyme that converts D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid comprises YcbF.

[0192] Embodiment 96. The recombinant cell of any one of Embodiments 93-95 wherein the recombinant cell exhibits conversion of D-glucaric acid to 4-deoxy-5-keto-D-glucaric acid at a level at least 110% of a wild-type control.

[0193] Embodiment 97. The recombinant cell of any one of Embodiments 93-96 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid.

[0194] Embodiment 98. The recombinant cell of Embodiment 97 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

[0195] Embodiment 99. The recombinant cell of Embodiment 97 or Embodiment 98 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises YcbC.

[0196] Embodiment 100. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid.

[0197] Embodiment 101. The recombinant cell of Embodiment 100 wherein the enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid comprises an aldonic acid dehydratase.

[0198] Embodiment 102. The recombinant cell of Embodiment 100 or Embodiment 101 wherein the enzyme that converts D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid comprises YcbH.

[0199] Embodiment 103. The recombinant cell of any one of Embodiments 100-102 wherein the recombinant cell exhibits conversion of D-galactaric acid to 4-deoxy-5-keto-D-glucaric acid at a level at least 110% of a wild-type control.

[0200] Embodiment 104. The recombinant cell of any one of Embodiments 100-103 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid.

[0201] Embodiment 105. The recombinant cell of Embodiment 104 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

[0202] Embodiment 106. The recombinant cell of Embodiment 104 or Embodiment 105 wherein the enzyme that converts 4-deoxy-5-keto-D-glucaric acid to 2,5-dioxopentanoic acid comprises YcbC.

[0203] Embodiment 107. The recombinant cell of Embodiment 48 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline.

[0204] Embodiment 108. The recombinant cell of Embodiment 107 wherein the enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline comprises an amino acid transporter.

[0205] Embodiment 109. The recombinant cell of Embodiment 107 or Embodiment 108 wherein the enzyme that converts 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline comprises LysE or HypE.

[0206] Embodiment 110. The recombinant cell of any one of Embodiments 107-109 wherein the recombinant cell exhibits conversion of 4(R)-hydroxy-L-proline to 4(R)-hydroxy-D-proline at a level at least 110% of a wild-type control.

[0207] Embodiment 111. The recombinant cell of any one of Embodiments 107-110 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-.delta.-pyrroline.

[0208] Embodiment 112. The recombinant cell of Embodiment 111 wherein the enzyme that converts 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-.delta.-pyrroline comprises HypOX.

[0209] Embodiment 113. The recombinant cell of Embodiment 111 or Embodiment 112 wherein the recombinant cell exhibits conversion of 4(R)-hydroxy-D-proline to 2-carboxy-4(R)-hydroxy-.delta.-pyrroline at a level at least 110% of a wild-type control.

[0210] Embodiment 114. The recombinant cell of any one of Embodiments 107-113 wherein the engineered metabolic pathway for converting a carbon source to 2,5-dioxopentanoic acid comprises an enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid.

[0211] Embodiment 115. The recombinant cell of Embodiment 114 wherein the enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid comprises a 2-keto-3-deoxyaldonic acid dehydratase.

[0212] Embodiment 116. The recombinant cell of Embodiment 114 or Embodiment 115 wherein the enzyme that converts 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid comprises PP1247.

[0213] Embodiment 117. The recombinant cell of any one of Embodiments 114-116 wherein the recombinant cell exhibits conversion of 2-oxo-4(R),5-hydroxy-5-aminopentanoic acid to 2,5-dioxopentanoic acid at a level at least 110% of a wild-type control.

[0214] Embodiment 118. The recombinant cell of any one of Embodiments 48-117 modified to exhibit increased .alpha.-ketoglutaric semialdehyde dehydrogenase activity compared to a wild-type control.

[0215] Embodiment 119. The recombinant cell of Embodiment 118 exhibiting increased conversion of 2,5-dioxopentanoic acid to a TCA derivative compared to a wild-type control.

[0216] Embodiment 120. The recombinant cell of Embodiment 119 wherein the TCA derivative comprises succinate, fumarate, malate, glutamate, lysine, threonine, or 4-hydroxybutyrate.

[0217] Embodiment 121. The recombinant cell of any preceding Embodiment genetically modified to increase consumption of xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline compared to a wild-type control.

[0218] Embodiment 122. The recombinant cell of any preceding Embodiment genetically modified to in crease consumption of a uronic acid compared to a wild-type control.

[0219] Embodiment 123. The recombinant cell of Embodiment 122 wherein the urnic acid comprises galacturonic acid or glucuronic acid.

[0220] Embodiment 124. The recombinant cell of Embodiment 122 or Embodiment 123 genetically modified to increase conversion of the uronic acid to an aldonic acid compared to a wild-type control.

[0221] Embodiment 125. The recombinant cell of any one of Embodiments 122-124 wherein the recombinant cell comprises an exogenous urinate dehydrogenase.

[0222] Embodiment 126. A method comprising:

[0223] incubating a recombinant cell of any preceding Embodiment in medium that comprises a carbon source under conditions effective for the recombinant cell to produce a TCA derivative.

[0224] Embodiment 127. The method of Embodiment 126 wherein the TCA derivative comprises 1,4-butanediol.

[0225] Embodiment 128. The method of Embodiment 126 wherein the carbon source comprises xylose, arabinose, glucaric acid, galactaric acid, or hydroxyproline.

[0226] Embodiment 129. The method of any one of Embodiments 126-128 wherein the increased biosynthesis of the TCA derivative comprises an increase in pentose dehydrogenase activity, pentonolactonase activity, aldonic acid dehydratase activity, or 2-keto-3-deoxyaldonic acid dehydratase activity.

[0227] Embodiment 130. The method of any one of Embodiments 126-129 wherein the increased biosynthesis of the TCA derivative comprises an increase in hexic acid dehydratase activity or 5-dehydro-4-deoxyglucarate dehydratase activity.

[0228] Embodiment 131. A method comprising:

[0229] introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes conversion of a carbon source to a TCA derivative, wherein the at least one polypeptide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to TCA derivative.

[0230] Embodiment 132. The method of Embodiment 131 wherein the TCA derivative comprises 1,4-butanediol.

[0231] Embodiment 133. The method of Embodiment 131 wherein the carbon source comprises xylose.

[0232] Embodiment 134. The method of Embodiment 131 wherein the TCA derivative comprises succinate, fumarate, malate, glutamate, lysine, threonine, 4-hydroxybutyrate.

[0233] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

[0234] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0235] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0236] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

TABLE-US-00004 Sequence Listing Free Text D-arabinose dehydrogenase (AraDH) (NP_342747.1; GI: 15898142; Zinc-containing alcohol dehydrogenase (Sulfolobus solfataricus P2)) SEQ ID NO: 1 1 menvnmvksk aallkkfsep lsiedvnipe pqgeevliri ggagvcrtdl rvwkgveakq 61 gfrlpiilgh enagtivevg elakvkkgdn vvvyatwgdl tcrycregkf nicknqiipg 121 qttnggfsey mlvkssrwlv klnslspvea apladagtts mgairqalpf iskfaepvvi 181 vngigglavy tiqilkalmk nitivgisrs kkhrdfalel gadyvsemkd aeslinkltd 241 glgasiaidl vgteettynl gkllaqegai ilvgmegkrv sleafdtavw nkkllgsnyg 301 slndledvvr lsesgkikpy iikvplddin kaftnldegr vdgrqvit (Chain A, D-arabinose dehydrogenase (Sulfolobus solfataricus)) SEQ ID NO: 2 1 mvkskaallk kfseplsied vnipepqgee vliriggagv crtdlrvwkg veakqgfrlp 61 iilghenagt ivevgelakv kkgdnvvvya twgdltcryc regkfnickn qiipgqttng 121 gfseymlvks srwlvklnsl spveaaplad agttsmgair qalpfiskfa epvvivngig 181 glavytiqil kalmknitiv gisrskkhrd falelgadyv semkdaesli nkltdglgas 241 iaidlvgtee ttynlgklla qegaiilvgm egkrvsleaf dtavwnkkll gsnygslndl 301 edvvrlsesg kikpyiikvp lddinkaftn ldegrvdgrq vitp (Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus islandicus M.14.25)) SEQ ID NO: 3 1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl 61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf 121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf 181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs kkhrdlalel gadyavemke 241 aesliskltd glgasvaidl vgteetsynl gkllaqegai ilvgmegkrv sleafdtavw 301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp (Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus islandicus M.16.27)) SEQ ID NO: 4 1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl 61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf 121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf 181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs rkhrdlalel gadyavemke 241 aesliskltd glgasvaidl vgteetsynl gkllagegai ilvgmegkrv sleafdtavw 301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp (Alcohol dehydrogenase GroES domain-containing protein (Sulfolobus islandicus L.S.2,15)) SEQ ID NO: 5 1 mfgitfysam rknismvksk aallkkfsep lsiedveipe pkgeevlvri ggagvcrtdl 61 rvwkgveakq gfrlpiilgh enagtvvevg elakakkgdn vvvyatwgdm tcrycregkf 121 nicknqvipg qttnggfsey mlvksyrwlv kldslspvda spladagtts mgairqalpf 181 mnkfaepvvi vngigglavy tiqilkalmk nivivgisrs kkhrdlalel gadhavemke 241 aesliskltd glgasvaidl vgteetsynl gkllaqegai ilvgmegkrv sleafdtavw 301 nkkllgsnyg slndledvvr lsesgkikpy vvkipldein kafkdldegr vegrqvitp Arabinonate dehydratase (AraD) (NP_344435.1; GI: 15899830; Mandelate racemase/muconate lactonizing family protein (Sulfolobus solfataricus P2)) SEQ ID NO: 6 1 mikdirtykl cyeginderd alaikglaeh pmeivateie tsdgyvgyge slaygcsdav 61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing protein (Sulfolobus islandicus Y.G.57.14)) SEQ ID NO: 7 1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav 61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing domain-containing protein (Sulfolobus islandicus L.D.8.5)) SEQ ID NO: 8 1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav 61 qvtiekilkp lllkedeefi eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyslip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing protein (Sulfolobus islandicus M.14.25)) SEQ ID NO: 9 1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav 61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdtg lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikvk igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks (Mandelate racemase/muconate lactonizing protein (Sulfolobus islandicus L.S.2.15)) SEQ ID NO: 10 1 mikdirtykl cyeginderd alaikglaeh pmeivvteie tsdgyvgyge slaygcsdav 61 qvtiekilkp lllkedeeli eylwdkmyka tlrfgrrgia iagisgvdta lwdimgkkak 121 kpiykllggs krkvrayitg gyysekkdle klrdeeayyv kmgfkgikik igaksmeedi 181 erlkairevv gedvkiavda nnvytfeeal emgrrleklg iwffeepiqt dyldlsarla 241 eelevpiagy etaytrwefy eimrkravdi vqtdvmwtgg isemmkignm akvmgyplip 301 hysaggisli gnlhvaaaln spwiemhlrk ndlrdkifke sieidnghlv vpdrpglgyt 361 irdgvfeeyk cks 2-Keto-3-deoxy-D-arabinonate Dehydratase (KdaD) (NP_344431.1; GI: 15899826; Hypothetical protein SSO3118 (Sulfolobus solfataricus P2) SEQ ID NO: 11 1 mhfimmklfr vvkrgyyisy aildnstiir ldedpikalm rysenkevlg drvtgidyqs 61 llksfqindi ritkpidppe vwgsgisyem areryseenv akilgktiye kvydavrpei 121 ffkatpnrcv ghgeaiavrs dsewtlpepe lavvldsngk ilgytimddv sardleaenp 181 lylpqskiya gccafgpviv tsdeiknpys lditlkivre grvffegsvn tnkmrrkiee 241 gigylirdnp ipdgtilttg taivpgrdkg lkdediveit isnigtlitp vkkrrkit (Fumarylacetoacetate (FAA) hydrolase (Sulfolobus islandicus Y.N.15.51)) SEQ ID NO: 12 1 mltcllptll yakcifimmk lfrvvkrgyy isyaildnst iirldedpik almrysenke 61 vlgdrvtgid yqsllksfqi ndiritkpid ppevwgsgis yemareryse envakilgkt 121 iyekvydavr peiffkatpn rcvghgeaia vrsdsewtlp epelavvlds ngkilgytim 181 ddvsardlea enplylpqsk iyagccafgp vivtsdeikn pyslditlki vregrvffeg 241 svntnkmrrk ieegigylir dnpipdgtil ttgtaivpgr dkglkdediv eitisnigtl 301 itpvkkrrki t (Fumarylacetoacetate (FAA) hydrolase (Sulfolobus solfataricus 98/2)) SEQ ID NO: 13 1 mmklfrvvkr gyyisyaild nstiirlded pikalmryse nkevlgdrvt gidyqsllks 61 fqindiritk pidppevwgs gisyemarer yseenvakil gktiyekvyd avrpeiffka 121 tpnrcvghge aiavrsdsew tlpepelavv ldsngkilgy timddvsard leaenplylp 181 qskiyagcca fgpvivtsde iknpysldit lkivregrvf fegsvntnkm rrkieegiqy 241 lirdnpipdg tilttgtaiv pgrdkglkde diveitisni gtlitpvkkr rkit (Chain X, 2-keto-3-deoxy4)-arabinonate dehydratase) SEQ ID NO: 14 1 mklfrvvkrg yyisyaildn stiirldedp ikalmrysen kevlgdrvtg idyqsllksf 61 qindiritkp idppevwgsg isyemarery seenvakilg ktiyekvyda vrpeiffkat 121 pnrcvghgea iavrsdsewt lpepelavvl dsngkilgyt imddvsardl eaenplylpq 181 skiyagccaf gpvivtsdei knpyslditl kivregrvff egsvntnkmr rkieeqiqyl 241 irdnpipdgt ilttgtaivp grdkglkded iveitisnig tlitpvkkrr kit (Fumarylacetoacetate (FAA) hydrolase (Sulfolobus islandicus HVE10/4)) SEQ ID NO: 15 1 mmklfrvvkr gyyisyaild nstiirlded pikalmryse nkevlgdrvt gidyqsllks 61 fqindiritk pidppevwgs gisyemarer yseenvakil gktiyekvyd avrpeiffka 121 tpnrcvghge aiavrsdsew tlpepelavv ldsngkilgy timddvsard leaenplylp 181 qskiyagcca fgpvivtsde iknpysldit lkivrkdrvf fegsvntnkm rrkieeqiqy 241 lirdnpipdg tilttgtaiv pgrdkglkde diveitisni gtlitpvkkr rkit 2,5-dioxopentanoate dehydrogenase (DopDH) (NP_344430.1; GI: 15899825; Aldehyde dehydrogenase (Sulfolobus solfataricus P2) SEQ ID NO: 16 1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp 61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus HVE10/4)) SEQ ID NO: 17

1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp 61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalgfkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli ihkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knagakliyg gniipgkgyf 361 leptifegvt shmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus Y.G.57.14)) SEQ ID NO: 18 1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp 61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdinain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus Y.N.15.51)) SEQ ID NO: 19 1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp 61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntai ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael avrggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw (Aldehyde dehydrogenase (Sulfolobus islandicus L.S.2.15)) SEQ ID NO: 20 1 mksyqgladk wikgsgeeyl dinpadkdhv lakirlytkd dvkeainkav akfdewsrtp 61 apkrgsillk agelmeqeaq efallmtlee gktlkdsmfe vtrsynllkf ygalafkisg 121 ktlpsadpnt riftvkeplg vvalitpwnf plsipvwkla palaagntav ikpatktplm 181 vaklvevlsk aglpegvvnl vvgkgsevgd tivsddniaa vsftgstevg kriyklvgnk 241 nrmtriqlel ggknalyvdk sadltlaael airggfgltg qsctatsrli inkdvytqfk 301 qrllervkkw rvgpgtedvd mgpvvdegqf kkdleyieyg knvgakliyg gniipgkgyf 361 leptifegvt sdmrlfkeei fgpvlsvtea kdldeairlv navdyghtag ivasdikain 421 efvsrveagv ikvnkptvgl elqapfggfk nsgattwkem gedalefylk ektvyegw 2,5-dioxovalerate dehydrogenase (YcbD) (NP_388129.1; GI: 16077316; 2,5-dioxovalerate dehydrogenase (Bacillus subtilis subsp. subtilis str. 168)) SEQ ID NO: 21 1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaedv eravtaanea 61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdgvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsieealni andvkfglsa 421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp (Aldehyde dehydrogenase, thermostable (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 22 1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaedv eravaaanea 61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehegvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsraivqsg 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealni andvkfglsa 421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp (Hypothetical protein BSNT_00439 (Bacillus subtilis subsp natto BEST195)) SEQ ID NO: 23 1 msviteqnty lnfikgewvk sqsgdmvkve npadvndivg yvqnstaedv eravaaanea 61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkaalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdgvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqse 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 lengkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealni andvkfglsa 421 siftenigrm lsfideidag lvrinaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp (Aldehyde dehydrogenase (Bacillus subtilis subsp. spizizenii TU-B-10)) SEQ ID NO: 24 1 msviteqnty lnfingewvk sqsgdmvkve npadvndivg yvqnstaddv eravaaanea 61 ktawrkltga ergqylykta dimeqrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehegvnait ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg 301 iydrfkekll qrtkdikigd slkedvwmgp iasknqldnc lsyiekgkqe gaslliggek 361 ledgkyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealdi andvkfglsa 421 siftqnigrm lsfvdeidag lvrinaesag velqapfggm kqssshsreq geaakdffta 481 iktvfvkp (Aldehyde dehydrogenase (Bacillus sp. JS)) SEQ ID NO: 25 1 msviteqnty lnfingewvq sqsgdmvkve npadvndivg yvqnstaedv eravaaanka 61 ktawrkltga ergqylykta dimerrleei aacatremgk tlpeakgeta rgiailryya 121 gegmrktgdv ipstdkdalm fttrvplgvv gvispwnfpv aipiwkmapa lvygntvvik 181 patetavtca kiiacfeeag lpagvinlvt gpgsvvgqgl aehdsvnavt ftgsnqvgki 241 igqaalarga kyqlemggkn pvivaddadl eaaaeavitg afrstgqkct atsrvivqsg 301 iyerfkekll qrtkditigd slkedvwmgp iasknqldnc lsyiekgkre gasllmggek 361 lenekyqngy yvqpaifdnv tsemtiaqee ifgpvialik vdsmeealdi andvkfglsa 421 siftenigkm lsfideidag lvrvnaesag velqapfggm kgssshsreq geaakdffta 481 iktvfvkp Xylose dehydrogenase (xylB) (YP_002516237.1; GI: 221233801; Xylose dehydrogenase xylB (Caulobacter crescentus NA1000)) SEQ ID NO: 26 1 mssaiypslk gkrvvitggg sgigagltag farqgaevif ldiadedsra leaelagspi 61 ppvykrcdlm nleaikavfa eigdvdvlvn nagnddrhkl advtgaywde rinvnlrhml 121 fctqavapgm kkrgggavin fgsiswhlgl edlvlyetak agiegmtral arelgpddir 181 vtcvvpgnvk tkrqekwytp egeaqivaaq clkgrivpen vaalvlflas ddaslctghe 241 ywidagwr (Oxidoreductase, short-chain dehydrogenase/reductase (Phenylobacterium zucineum HLK1)) SEQ ID NO: 27 1 mgvtsaiyps lkgkrvvvtg ggsgigaglv eafvrqgaev hfldvletes rvletslaga 61 evppvfhrcd ltdagaiegc fakigpvqvl vnnagnddrh tldevtpayf ddriavnlrh 121 mvfcakavvp amkaagegai infgsiswhl glpdlvlyet akagiegmtr alarelgpfg 181 irvtcvapgn vktlrqmkwy tpegeaeiva qqclksriep advaalvlfl asddarmctg 241 heywidagwr (Dehydrogenase of unknown specificity, short-chain alcohol dehydrogenase (Caulobacter sp. AP07)) SEQ ID NO: 28 1 mssaiypslq gkrvvvtggg sgigagivaa farqgaevif ldvvdadsea laaklsdspi 61 aptymrcdlt dleamaetfa rigpidvlvn nagnddrhgl aeitpaywdq rmavnlrhml 121 fatqavapgm kargggavin fgsiswhlgl pdlvlyetak agiegmtral arelgpddir 181 vtcvvpgnvk tkrqekwytp egeaeivaaq alkgrlvpdh vaslvlflas ddaalctghe 241 ywidagwr (Short-chain dehydrogenase/reductase SDR (Caulobacter sp. K31)) SEQ ID NO: 29 1 mnievkrpqv stssaiypsl kgkrvvvtgg gsgigagiva gfarqgsevi fldvadqdsk 61 alaeqlsgae iapvylrcdl tdldavaktf adigpvdvlv nnagnddrhg laqitpaywd 121 ermsvnlrhm lfatqavapg mkargggaii nfgsiswhlg lpdlvlyeta kagiegmtra 181 larelgpddi rvtcvvpgni ktkrqekwyt pegeaeivaa galkgrlvpd hvaslvmfla 241 sddaslctgh eywidagwr (Short-chain dehydrogenase/reductase SDR (Caulobacter segnis ATCC 21756)) SEQ ID NO: 30 1 mssaiypslk gkrvvitggg sgigaglvag fvrqgaevif ldivdadsqa lvaelskdav 61 iapvykrcdl mdidalkatf aeigdvdvlv nnagnddrhs ladltpaywd nrigvnlrhm 121 vfaaqavagg mkkrgggaii nfgsiswhlg ledlvlyeta kagiegmtra larelgpddi 181 rvtcvvpgnv ktkrqekwyt pegeaeivka gclkgrilpd hvaslvlfla sddaslctgh 241 eywidagwr Xylonolactonase (xylC) (YP_002516236.1; GI: 221233800; Xylonolactonase xylC (Caulobacter crescentus NA1000)) SEQ ID NO: 31 1 mtaqvtcvwd lkatlgegpi whgdtlwfvd ikqrkihnyh patgerfsfd apdqvtflap 61 ivgatgfvvg lktgihrfhp atgfslllev edaalnnrpn datvdaggrl wfgtmhdgee 121 nnsgslyrmd ltgvarmdrd icitngpcvs pdgktfyhtd tlektiyafd laedgllsnk 181 rvfvqfalgd dvypdgsvvd segylwtalw ggfgavrfsp qgdavtriel papnvtkpcf

241 ggpdlktlyf ttarkglsde tlaqyplagg vfavpvdvag qpqhevrlv (SMP-30/gluconolaconase/LRE domain-containing protein (Caulobacter segnis ATCC 21756)) SEQ ID NO: 32 1 mtaevtcvwd lkatlgegpi whgdalwfvd ikqrkihnyk pttgehfsfd apdqvtflap 61 iadaggfvvg lktgihrfhp itgfrlliev edsaldnrpn datvdangrl wfgtmhdgee 121 aksgslyrmd aegvarmdkd icitngpcvs pdgktfyhtd tlektvwayd laedgtlsnk 181 rafvhvklgd diypdgtvvd segclwialw ggfgvirvsp ageivgriev papnvtkvcf 241 ggpdlktlfl ttarkglsde tlaqyplagg lfaigvniag qpqhevrlv (Gluconolactonase (Cautobacter sp. AP07)) SEQ ID NO: 33 1 mpepicvwdl katlgegpiw iaaeqalwfv dikshkvhrf hpesgetksf dapdqvtfla 61 pragggfvag lksglhhfhp etgfaylgei epadlnnrpn datvdaegrl wfgtmhdgee 121 tptgalyrlg adgqpvqqdq gvcitngpcv spdgktfyht dtlekviway dlgadgelsn 181 krqffrleid dawpdgsvvd aegyvwaalw gghgairisp agelvdrvtl painvtkpcf 241 ggpdlktlyf ttarkglgde glaayplcgg vfalpvavag qpgyevrldl p (SMP-30/gluconolaconase/LRE domain-containing protein (Cautobacter sp. K31)) SEQ ID NO: 34 1 mpepicvwdl katlgegpiw saeeqavwfv dikghkvhrf hpasgatasf dapdqvtfla 61 phaggggfva glksglhrfd pttgafvfla qieppelnnr pndatvdaeg rlwfgtmhdg 121 emtptgalyr lsadgkpiqg degvcitngp caspdgktfy htdtlekviw aydlgadgsl 181 snkreffrle iadawpdgsv vdsegfvwta lwgghgalrl spageivdrv ilpainvtkp 241 cfggpdlktv yftsarkgls deqlaaypqc gglfalpvav agqpqyevrl dlr (Gluconolactonase (Phenylobacterium zucineum HLK1)) SEQ ID NO: 35 1 mkvlsepdcv lradaelgeg pvwradddav wfvdikgrri hryepvtgaa wswaapaqpg 61 fiapvagggw vaglktglhr feprggrfel itavedpsld nrindgfvda kgrlwfgsmh 121 dgetaltgal yrlderglqr cdtgycitng paaspdgrtl yhtdtlqkti yafdlspage 181 lsnkrvfari eegggypdgp avdaegcvwt glfagwhvrr yspkgellak vgfpvanitk 241 lafggddlts vyattawkgl saderekqpl agglfrfevd vpglpqnqma ha D-xylonate dehydratase (xylD) (NP_419636.1; GI: 16125072; Dihydroxy-acid dehydratase)Caulobacter crescentus CB15)) SEQ ID NO: 36 1 mrsalsnrtp rrfrsrdwfd npdhidmtal ylerfmnygi tpeelrsgkp iigiaqtgsd 61 ispcnrihld lvqrvrdgir daggipmefp vhpifencrr ptaaldrnls ylglvetlhg 121 ypidavvltt gcdkttpagi maattvnipa ivlsggpmld gwhenelvgs gtviwrsrrk 181 laageiteee fidraassap saghcntmgt astmnavaea lglsltgcaa ipapyrergq 241 mayktgqriv dlayddvkpl diltkqafen aialvaaagg stnaqphiva marhagveit 301 addwraaydi plivnmqpag kylgerfhra ggapavlwel lqqgrlhgdv ltvtgktmse 361 nlqgretsdr evifpyhepl aekagflvlk gnlfdfaimk ssvigeefrk rylsqpggeg 421 vfearaivfd gsddyhkrin dpaleiderc ilvirgagpi gwpgsaevvn mqppdhllkk 481 gimslptlgd grqsgtadsp silnaspesa iggglswlrt gdtiridlnt grcdalvdea 541 tiaarkqdgi pavpatmtpw qeiyrahasq ldtggvlefa vkyqdlaakl prhnh (Dihydroxy-acid dehydratase (Caulobacter sp. K31)) SEQ ID NO: 37 1 mtsantpsgr pprrfrsrdw fdnpdhidmt alylerfmny gitpeelrsg kpiigiaqtg 61 sdispcnrih ldlvtrirdg irdaggipme fpvhpifenc rrptaaldrn lsylglvevl 121 hgypidavvl ttgcdkttpa gimaattvni paivlsggpm ldgwhdgelv gsgtviwrsr 181 rklaageine eefiqrasds apsaghcntm gtastmnava ealglsltgc aaipapyrer 241 gqmayktgqr ivdlayedvk pldiltkkaf enaialvaaa ggstnaqphi vamarhagld 301 itaddwraay diplilnmqp agkylgerfh raggapavlw ellqagrlhg dvmtvtgktm 361 genlegretk drevvfpygq pmseragflv lkgnlfdfai mktsvisqef rqrylsepgk 421 edsfearavv fdgsddyhar indpslnide rtilvirgag pigwpgsaev vnmqppdall 481 krgimslptl gdgrqsgtad spsilnaspe saiggglswl rtgdmiridl ntgrcdalvd 541 eatiaerrke gvppvpatmt pwqeiyraht gqletggvle favkyqdlas klprhnh (Dihydroxyacid dehydratase/phosphogluconate dehydratase (Caulobacter sp. AP07)) SEQ ID NO: 38 1 mtspnrtprr frsrdwfdnp dhidmtalyl erfmnygitp eelrsgkpii giaqtgsdis 61 pcnrihldlv trirdgirda ggipmefpvh pifencrrpt aaldrnlsyl glvetlhgyp 121 idavvlttgc dkttpagima attvnipaiv lsggpmldgw hdgelvgsgt viwrsrrkla 181 ageiteeefi qrasdsapsa ghcntmgtas tmnavaealg lsltgcaaip apyrergqma 241 yrtggrivdl ayedikpkdi ltkqafenai alvaaaggst naqphivama rhagldvtad 301 dwraaydipl ilnmqpagky lgerfhragg apavlwellq agrlhgdamt vtgktmaenl 361 egretrdrev vfpyaapmse ragflvlkgn lfdfaimkts visqefrdry lsepgqegaf 421 earavvfdgs gdyharindp slgidertil virgagpigw pgsaevvnmq ppdallkkgi 481 mslptlgdgr qsgtadspsi lnaspesavg gglswlrtgd viridlntgr cdalvdeati 541 aarkleglpp vpetmtpwqe iyrahtgqle tggvlefavk yqdlaaklpr hnh (Dihydroxy-acid dehydratase (Caulobacter segnis ATCC 21756)) SEQ ID NO: 39 1 msertprrfr srdwfdnpdh idmtalyler fmnygitpee lrsgkpiigi aqtgsdispc 61 nrihldlvtr irdgirdagg ipmefpvhpi fencrrptaa ldrnlsylgl vetlhgypid 121 avvittgcdk ttpagimaat tvnipaivls ggpmldgwhe gelvgsgtvi wrsrrklaag 181 eiteeefidr aassapsagh cntmgtastm navaealgls ltgcaaipap yrergqmayk 241 tgqrivdlay edvkpldilt kkafqnaial vaaaggstna qphivamarh agveitaddw 301 raaydipliv nmqpagkylg erfhraggap avlwellqqg rlhgdvltvt gktmgenlqg 361 retsdrevif pyhqplaeka gflvlkgnlf dfaimkssvi geefrkryls epgkegvfea 421 raivfdgsdd yhkrindpal eidercilvi rgagpigwpg saevvnmqpp dhllkkgims 481 lptlgdgrqs gtadspsiln aspesaiggg lswlrtgdti ridintgrcd alvdeatiae 541 rkkegipavp atmtpwqeiy rahtgqlesg gvlefavkyq dlasklprhn h (Dihydroxy-acid dehydratase (Caulobacter crescentus NA1000)) SEQ ID NO: 40 1 msnrtprrfr srdwfdnpdh idmtalyler fmnygitpee lrsgkpiigi aqtgsdispc 61 nrihldlvqr vrdgirdagg ipmefpvhpi fencrrptaa ldrnlsylgl vetlhgypid 121 avvlttgcdk ttpagimaat tvnipaivls ggpmldgwhe nelvgsgtvi wrsrrklaag 181 eiteeefidr aassapsagh cntmgtastm navaealgls ltgcaaipap yrergqmayk 241 tgqrivdlay ddvkpldilt kqafenaial vaaaggstna qphivamarh agveitaddw 301 raaydipliv nmqpagkylg erfhraggap avlwellqqg rlhgdvltvt gktmsenlqg 361 retsdrevif pyheplaeka gflvlkgnlf dfaimkssvi geefrkryls qpgqegvfea 421 raivfdgsdd yhkrindpal eidercilvi rgagpigwpg saevvnmqpp dhllkkgims 481 lptlgdgrqs gtadspsiln aspesaiggg lswlrtgdti ridlntgrcd alvdeatiaa 541 rkqdgipavp atmtpwqeiy rahasqldtg gvlefavkyq dlaaklprhn h 2-Keto-3-deoxy-D-arabinonate Dehydratase (xylX) (NP_419640.1; GI: 16125076; Hypothetical protein CC_0823 (Caulobacter crescentus CB15)) SEQ ID NO: 41 1 mvcrrllawt arareaedfa lvrqptcrph mlalpsader apptvsalqt lefwgddavg 61 vseflpedwk aatllgridf gegptpvlvr ggrvedvski aptvadlmna fqpgaviprg 121 edkgpleald irpvwedpdg aapvkllapv dlqclkaagv tfavstlerv ieerargdag 181 ealkirtlla ermggdlksv epgsggagrl kdaliadglw sqylevaigp daeiftkgpt 241 lssmgwgdqv gvrydshwnn pepevvalcd gsglirgaal gndvnlrdfe grsalllska 301 kdnnascaig pffrlfdetf glddvrsaev elkitgrdnf vldgksnmsl isrdpavlag 361 qaygkqhqyp dgfalflgtm fapiqdrdtp gqgfthkvgd rvrvstpklg vlenevttcd 421 kakpwtfgis alirnlagrg ll (Fumarylacetoacetate hydrolase family protein (Caulobacter crescentus NA1000)) SEQ ID NO: 42 1 mgvseflped wkaatllgri dfgegptpvl vrggrvedvs kiaptvadlm nafqpgavip 61 rgedkgplea ldirpvwedp dgaapvklla pvdlqclkaa gvtfavstle rvieerargd 121 agealkirtl laermggdlk svepgsqgaq rlkdaliadg lwsqylevai gpdaeiftkg 181 ptlssmgwgd qvgvrydshw nnpepevyll cdgsglirga algndvnlrd fegrsallls 241 kakdnnasca igpffrlfde tfglddvrsa evelkitgrd nfvldgksnm slisrdpavl 301 agqaygkqhq ypdgfalflg tmfapiqdrd tpgqgfthkv gdrvrvstpk lgvlenevtt 361 cdkakpwtfg isalirnlag rgll (Fumarylacetoacetate (FAA) hydrolase (Caulobacter segnis ATCC 22756)) SEQ ID NO: 43 1 mgvseflpdd wknatllgri dfgegptpvl vrggrvedms kvaptvadlm nafgpgaaip 61 rgedkgples ldirpvwedp dgaapvklla pvdlqclkaa gvtfavstle rvieerargd 121 aaaalkireq lsasmggdlr svnpgsegae rlkqtlikdg lwsqylevai gpdaeiftkg 181 ptlssmgwgd hvgvrydshw nnpepevvll cdgagqirga slgndvnlrd fegrsallls 241 kakdnnasca igpffrlfde tfalddvrsa evelkitgrd nfvldgksnm slisrdpavl 301 agqaygkqhq ypdgfalflg tmfapiqdrd tpgqgfthkv gdrvrvstpk lgvlenevtt 361 cdkakpwtfg isalirnlag rgll (Hypothetical protein Caul_4000 (Caulobacter sp. K31)) SEQ ID NO: 44 1 malsdflpdd wrdatllgri dfgqgptpvl irggriedvs kiapttsdlm nafapgaaip 61 rgedlgplea ldvravwenp qgaaakllap vdlqvlkaag vtfavstler vieerargda 121 aealkiraql adsmggdlrs vnpgsdgaer lkqtlikdgl wsqylevaig pdaeiftkgp 181 tlssmgwgdh vgvrsdshwn npepevvllc dgsgqirgaa lgndvnlrdf egrsalllsk 241 akdnnascai gpffrlfddg fslddvrsae vtlkitgrdn fvldghsnms lisrdpavla 301 gqafgkqhqy pdgfalflgt mfapiqdrda agqgfthkvg drvrvatpkl gvlenevttc 361 dlaapwtfgv salirnlagr gll (Fumarylacetoacetate (FAA) hydrolase family protein (Cautobacter sp. AP07)) SEQ ID NO: 45 1 malsdflpdd wrdatllgrv dfgdgptpvl vrggriedvs riapttsdlm nafapgaaip 61 agadlgplea ldvrpvwenp dgaaakllap vdlqvlkaag vtfavstler vieerargda 121 aealkiraql adsmggdlrg vnpgsegaar lketlikggl wsqylevaig pdaeiftkgp 181 tlssmgwgdq vgvrsdshwn npepevvllc dgsgrirgas lgndvnlrdf egrsalllsk 241 akdnnascai gpffrlfddg fglddvrsae vtlkitgrdn fvldghsnms lisrdpavla 301 gqafgkqhqy pdgfvlflgt mfapiqdrdt agqgfthkvg drvrvatpkl gvlenevttc

361 dvappwtfgv salirnlagr gll L-arabinose dehydrogenase (AraE) (YP_439823.1; GI: 83716868; Dehydrogenase (Burkholderia thailandensis E264)) SEQ ID NO: 46 1 mnsvytlglv gigkiardqh lpaiaaepgf dllacasrha qvrgvrnypd idallaaepa 61 ldayslaapp qvryaqaraa lgagkhvmle kppgatagei aalralarer grtlfaawhs 121 rhasavepar awlatrtira vqarwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlra atlvvpanah tpiaaeldcv dtagvpvrae fdwrhgpveq wdiavdtdgg 241 vlsigaggar lsiagepval ppereypsly arfraligeg asdvddrplr lvadafmigr 301 riaadpfqr (Dehydrogenase (Burkholderia thailandensis TXDOH)) SEQ ID NO: 47 1 mnsvytlglv gigkiardqh lpaiaaepgf dllacasrha qvrgvrnypd idallaaepa 61 ldavslaapp qvryaqaraa lgagkhvmle kppgatagei aalhalarer grtlfaawhs 121 rhasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlra ativvpanah tpiaaeldcv dtagvpvrae fdwrhgpveq wdiavdtdgg 241 vlsigaggar lsiagepval ppereypsly arfraligeg asdvddrplr lvadafmigr 301 riaadpfqr (Galactose 1-dehydrogenase (Burkholderia ambfiaria IOP40-10)) SEQ ID NO: 48 1 mskvislgvi gigkiardqh lpaiaaepgf altacasrha evngvrnype lgallaaepe 61 leavslcapp qvryaqaraa leagkhvmle kppgatlgev aaldalarer gltlfatwhs 121 rcasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlre atlyvpsdvq tpiaaeldca dtdgvpvhae fdwrhgpveq weiavdtsdg 241 vlaisrggaq lsiggepvei gpqreypaly ahfraliarg esdvdvrplr lvadaflfgr 301 rvgtdafgr (Galactose 1-dehydrogenase (Burkholderia ambifaria MC40-6)) SEQ ID NO: 49 1 mskvislgvi gigkiardqh lpaiaaepgf altacasrha evngvrnype lgallaaepe 61 leavslcapp qvryagaraa leagkhvmle kppgatlgev aaldalarer gltlfatwhs 121 rcasavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlre atlyvpsdvq tpiaaeldca dtdgvpvhae fdwrhgpveq weiavdtsdg 241 vlaisrggaq lsiagepvei gpqreypaly ahfraliarg esdvdvrplr lvadaflfgr 301 rvgtdafgr (Dehydrogenase (Burkholderia thailandensis MSMB43)) SEQ ID NO: 50 1 mntvytlglv gigkiardqh lpaiaaepgf dlracasrha evrgvrnhpd igallaaepa 61 ldavslaapp qvryaqaraa ldagkhvmle kppgatvgei aalralarer grtlfaswhs 121 rharavepar awlatrtira vqvrwkedvr rwhpgqqwiw epgglgvfdp ginalsivtr 181 ilprelvlra ativvpanvh tpiaaefdcv dtagvpvrae fdwrhgpveq wdiavdtdgg 241 vlaigaggar lsiagepval ppeceypsly arfhaliaar esdvddrplr lvadafmvgr 301 riaadpfhr L-arabinonolactonase (AraI) (YP_439819.1; GI: 83717359; Senescence marker protein-30 family protein (Burkholderia thailandensis E264)) SEQ ID NO: 51 1 messnrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg 61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr 121 cdragafvfg mkdegggspr avggyyrlnp dlslqrlalp laaiangitf spdgsamyfc 181 dsptreiqvc dyrpggdvdr irsfvrladd cgepdgsavd adggvwnaqw ggarivryda 241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla 301 tsrfalarna (Senescence marker protein-3O family protein (Burkholderia thailandensis TXDOH)) SEQ ID NO: 52 1 messsrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg 61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr 121 cdragafvfg mkdegggspr avggyyrinp dlslqrlalp paaiangiaf spdgsamyfc 181 dsptreiqvc dyrpggdvdr irpfvrladd cgepdgstvd adggvwsaqw ggarivryda 241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla 301 tsrfalarna (Senescence marker protein-30 family protein (Burkholderia thailandensis Bt4) SEQ ID NO: 53 1 messnrpart gaasaatlrv dcrnalgega twcdatraly wvdiegarlw rwraagaqgg 61 aatdswempe rigcfaltdd pdvllvglas rlaffdarrr aftpivdvep dlptrindgr 121 cdragafvfg mkdegggspr avggyyrlnp dlslqrlalp laaiangiaf spdgsamyfc 181 dsptreiqvc dyrpggdvdr irsfvrladd cgepdgsavd adggvwnaqw ggarivryda 241 qgveteriav ptpqpscval ddggrlyvts arvglddgal arspgaggvf vadtrhagla (Hypothetical protein BPSS0776 (Burkholderia pseudomallei K96243)) SEQ ID NO: 54 1 messnrpart heasaatllv dcrnalgega twcdaahaly wvdiegarlw rwraagahgg 61 ercdswempe riacfaltgd pdvllvglas rlaffdtrrr altpivdvep drptrindgr 121 cdragafvfg tkdesggasp raiggyyrln adlslqrlal ppaaiangia fspdgsamyf 181 cdsptreiqv cdyrpggdvd rvrsfvrlad ahgepdgstv dasggvwnaq wggarvvryd 241 aqgvetdria vptpqpscvt ldaagrlyvt sarvglddga lagnpgaggv fvahtrhsgs 301 atprfalarh a (Gluconolactonase (Burkholderia pseudomallei NCTC 13177)) SEQ ID NO: 55 1 messnrpart heasaatllv dcrnalgega twcdaahaly wvdiegarlw rwraagahgg 61 ercdswempe riacfaltgd pdvllvglas rlaffdtrrr altpivdvep drptrlndgr 121 cdragafvfg tkdesggasp raiggyyrln adlslqrlal ppaaiangia fspdgsamyf 181 cdsptreiqv cdyrpggdvd rvrsfvrlad ehgepdgstv dasggvwnaq wggarvvryd 241 aqgvetdria vptpqpscvt ldaagrlyvt sarvglddga lagnpgaggv fvahtrhpgg 301 atprfalarh a L-arabinonate dehydratase (AraB) (YP_439826.1; GI: 83718062; Dihydroxy-acid dehydratase (Burkholderia thailandensis E264)) SEQ ID NO: 56 1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf 61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngkldgkni gsgtavwqlh ealkageidl 181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahmsgmr 241 ivgmaheglv lskiltraaf enairvnaai ggstnavihl kaiagrlgvp leledwlrlg 301 rgtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngq slwdnvrdap 361 shddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfehyk 421 atiddealdv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dgeagtltld vsddelarrl sdhdpasapg 541 vaehaagggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh (Dihydroxy-acid dehydratase (Burkholderia thailandensis TXDOH)) SEQ ID NO: 57 1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf 61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngkldgrni gsgtavwqlh ealkageidl 181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahmsgmr 241 ivgmaheglv lskiltraaf enairvnaai ggstnavihl kaiagrlgvp leledwlrlg 301 rgtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngq slwdnvrdap 361 shddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfehyk 421 atiddealev dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dceagtltld vsddelarrl sdhdpasapg 541 vaehaagggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh (Dihydroxy-acid dehydratase (Burkholderia multivorans ATCC 17616)) SEQ ID NO: 58 1 msatkprlrs aqwfgtndkn gfmyrswmkn qgipdhefdg rpiigicntw seltpcnahf 61 rklaehvkrg ifeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngklegkni gsgtavwqlh ealkageidl 181 hhflsaeagm srsagtcntm gtastmacma ealgvalphn aaipavdsrr yvlahmsgir 241 ivemaleglv lskvltraaf enairvnaai ggstnavihl kaiagrigvp leledwmrig 301 rdtptivdlm psgrflmeef yyagglpavl rrlgeggllp hpdaltvngk tlwdnvreap 361 nyddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfdhyk 421 atindesldv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dceagtlhld ipddelqrrl sdvdpaaapg 541 vagqagkggy arlyldhvlq adegcdldfl vgtrgaevps hsh (Dihydroxy-acid dehydratase (Burkholderia multivorans CGD2M)) SEQ ID NO: 59 1 msatkprlrs aqwfgtndkn gfmyrswmkn qgipdhefdg rpiigicntw seltpcnahf 61 rklaehvkrg ifeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngklegkni gsgtavwqlh ealkageidl 181 hhflsaeagm srsagtcntm gtastmacma ealgvalphn aaipavdsrr yvlahmsgir 241 ivemaleglv lskvltraaf enairvnaai ggstnavihl kaiagrigvp leledwmrig 301 rdtptivdlm psgrflmeef yyagglpavl rrlgeggllp hpdaltvngk tlwdnvrdap 361 nyddevirpl drpliadggi rilrgnlapr gavlkpsaas pellkhrgra vvfenfdhyk 421 atindealdv dansvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwiel dceagtlhld ipddelqrrl sdvdpaaapg 541 vagqagkggy arlyldhvlq adegcdldfl vgtrgaevps hsh (Dihydroxy-acid dehydratase (Burkholderia thailandensis MSMB43)) SEQ ID NO: 60 1 msaskpklrs aqwfgthdkn gfmyrswmkn qgipdhefdg rpivgicntw seltpcnahf 61 rklaehvkrg vyeaggfpve fpvfsngesn lrpsamltrn lasmdveeai rgnpidavvl 121 lagcdkttpa llmgaascdv paivvsggpm lngkldgkni gsgtavwqlh ealkageidl 181 hrflsaeagm srsagtcntm gtastmacla ealgvalphn aaipavdarr yvlahlsgar 241 ivemahegla lstiltraaf enairanaai ggstnavihl kaiagrlgvp leledwmrig 301 rdtptivdlm psgrflmeef yyagglpavl rrlgeanllp hpgaltvngk slwenvrdap 361 nhddevirpl arpliadggi rvlrgnlapr gavlkpsaas pellrhrgra vvfenfehyk

421 atiddealdv dassvlvlkn cgprgypgma evgnmglppk llrqgvkdmv risdarmsgt 481 aygtvvlhva peaaaggpla avrngdwial dceagtltld vsddelarrl sdldpasapg 541 aagqagsggy arlyvdhvlq adegcdldfl vgrrgaavpr hsh 2-Keto-3-deoxy-L-arabinonate Dehydratase AraD) (YP_439824.1; GI: 83717217; Dihydrodipicolinate synthase (Burkholderia thailandensis E264)) SEQ ID NO: 61 1 mntsrspryr gvfpvvpttf aeageldlps qkravdfmid agseglcila nfseqfalad 61 derdvltrti lehvagrvpv ivttthystq vcaarsrraq elgaamvmam ppyhgatfrv 121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpive ahregradda 241 falygrwlpl inhenrqtgl laakalmreg gviacerprh plppihpdsr aeliaiarrl 301 dplvlrwar (Dihydrodipicolinate synthase, putative (Burkholderia thailandensis TXDOH)) SEQ ID NO: 62 1 mntsrspryr gvfpvvpttf teageldlps qkravdfmid agseglcila nfseqfalad 61 derdvltrti lehvagrvpv ivttthystq vcaarsrraq elgaamvmam ppyhgatfrv 121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpive ahregradda 241 falyqrwlpl inhenrqtgl laakalmreg gviacerprh plppihpdsr aeliaiarrl 301 dplvlrwar (Dihydrodipicolinate synthase, putative (Burkholderia thailandensis MSMB43)) SEQ ID NO: 63 1 mntsrspryr gvfpvvpttf tetgeldlps qmravdfmid agseglcila nfseqfalad 61 derdvltrti lehvagrvpv ivttthystr vcaarsrraq elgaamvmam ppyhgatfrv 121 pdtqihafya rlsdaldipi miqdapasgt vlsapflarm areieqvsyf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlna gatgamtgga ypdgirpivd ahrdgradda 241 falygrwlpl inhenrqtgl vaakalmreg gviacerprh plppihpdsr aelieiarrl 301 dplvlrwar (Dihydrodipicolinate synthase/N-acetylneuraminate lyase (Burkholderia dolosa AUO158)) SEQ ID NO: 64 1 mtssrtpryr gifpvvpttf tdtgeldlas qkravdfmid agsdglcila nfseqfaitd 61 derdvltrti lehvagrvpv ivttthystq vcaarslraq qlgaamvmam ppyhgatfrv 121 peaqiydfya rvsdaidipi miqdapasgt vlsapllarm areieqvsyf kietpgaank 181 lrelirlggd avegpwdgee aitlladlna gatgamtgga ypdgirpile ahregrhdda 241 fahyqrwlpl inhenrqsgi lsakalmreg gviacerprh pmpelhpdtr aeliaiarrl 301 dplvlrwar (Dihydrodipicolinate synthetase family protein (Burkholder multivorans ATCC BAA-247)) SEQ ID NO: 65 1 mtssrtpryr gifpvvpttf tetgeldlas qkravdfmid agsdglcila nfseqfalad 61 derdvltrti lehvagrvpv ivttshystq tciarsvraq qlgaamvmvm ppyhgatfrv 121 peaqihafya rlsdalsipi miqdapasgt vlsapflaql areiehvayf kietpgaank 181 lrelirlggd aiegpwdgee aitlladlha gatgamtgga ypdgirpile ahregrhdda 241 faryqtwlpl inhenrqsgi ltakalmreg gviaceaprh pmpalhpdtr aeliaiarrl 301 dplvlrwar D-glucarate dehydratase (YcbF) (NP_388131.2; GI: 255767063; Glucarate dehydratase (Bacillus subtilis subsp. subtilis str.168)) SEQ ID NO: 66 1 msspiqeqvq kekrsnipsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq 61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrnrt tlpyqsdeqs 181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah 421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr (Glucarate dehydratase (Bacillus subtilis)) SEQ ID NO: 67 1 msspiqeqvq kekrsnipsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq 61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldflgkflqe pvaallgegk qrdevkmlgy lfyigdrnrt tlpyqsdeqs 181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah 421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr (Hypothetical protein BSNT_00441 (Bacillus subtilis subsp. natto BEST195)) SEQ ID NO: 68 1 msspiqeqvq kekrsnipsi temkvipvag hdsmllnlsg ahspfftrni viltdssgnq 61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrkrt tlpyqsdeqs 181 dcawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lqgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgid idmeqvekah 421 eiyrkmnlga rndaipmqfl isnwefdrkr pclvr (Glucarate dehydratase (Bacillus subtilis subsp. spizizenii TU-B-10)) SEQ ID NO: 69 1 msspiqeqvq kekrsnipsi cemkvipvag hdsmllnlsg ahspfftrni viltdssgnq 61 gvgevpggeq irrtlelaep lvvgksigay qsilqtvrkq fadqdrggrg iqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk qrdevkmlgy lfyigdrkqt tlpyqsdeqs 181 dcgwfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgedeieav talakrfpea 241 ritldpngaw sleeaialck gkhdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmch dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeisegcvk vpnkpglgid idmeqvekah 421 elyrkmnlga rndavpmqfl isnwefdrkr pclvr (Glucarate dehydratase (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 70 1 msspmqeqiq kekrsnvpsi semkvipvag hdsmllnlsg ahspfftrni viltdssgnq 61 gvgevpggeh irrtlelsep lvvgksigay qailqtvrkq fgdqdrggrg nqtfdlrttv 121 havtaleaal ldllgkflqe pvaallgegk grdevkmlgy lfyigdrkrt tlpyqsdeqs 181 ycawfrlrhe ealtpeaivr laesaqeryg fqdfklkggv lrgeeeieav talskrfpea 241 ritldpngaw sleeaialck gkqdvlayae dpcgdengys arevmaefrr atglptatnm 301 iatdwremgh aiqlhavdip ladphfwtmq gsvrvaqmcn dwgltwgshs nnhfdislam 361 fthvaaaapg ritaidthwi wqdgqrltkq pfeissgcvk vpdkpglgvd idmeqvekah 421 eiyrkmnlga rndaipmqsl isnwefdrkr pclvr D-galactarate dehydratase (YcbH) (NP_388133.2; GI: 255767065; D-galactarate dehydratase (Bacillus subtilis subsp. subtilis str.168)) SEQ ID NO: 71 1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq 61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirlnsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt prayseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge rakqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (Hypothetical protein BSNT_00443 (Bacillus subtilis subsp. natto BEST195)) SEQ ID NO: 72 1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq 61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt prayseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlglaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (D-galactarate dehydratase (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 73 1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq 61 gdeivrygev igfadetikr gswirealvr mpappalddl planrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt prayseevgq slieemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (Hypothetical protein BSSC8_40810 (Bacillus subtilis subsp. subtilis str. SC-8)) SEQ ID NO: 74 1 mamnlrknqa plyikvheid ntaiivnegg lpkgtvfscg lvleedvpqg hkvaltdlnq 61 gdeivrygev igfadetikr gswirealvr mpappalddl plenrvpqpr pplegytfeg 121 yrnadgsagt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva

181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasendddil slqdhrgfaa 241 miqsilemae erlirinsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt pravseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge raeqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag qiatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt (Galactarate dehydratase (Bacillus subtilis BSn5)) SEQ ID NO: 75 1 mamnlrknqa plyikvheid ntaiivndgg lpkgtvfscg lvleedvpqg hkvaltdlnq 61 gdeivrygev igfadetikr gswiredlvr mpappalddl planrvpqpr pslegytfeg 121 yrnadgstgt knilgittsv qcvvgvldya vkrikeellp kypnvddvvp lhhqygcgva 181 inapdavipi rtiqnlakhp nfggevmvig lgcekllper iasengddil slqdhrgfaa 241 miqsilemae erlirlnsrt rvscpvsdlv iglqcggsda fsgvtanpav gyaadllvra 301 gatvlfsevt evrdaihllt pravseevgq slikemkwyd sylrrgdadr sanpspgnkk 361 gglsnvveka lgsvaksgts pisgvlgpge rakqkgllfa atpasdfvcg tlqlaagmnl 421 qvfttgrgtp yglaaapvlk vstrhslseh wadlidinag riatgeasie dvgweifrti 481 ldvasgrkqt wadrwglhnd lclfnpapvt 5-dehydro-4-deoxyglucarate dehydratase (YcbC) (NP_388128.2; GI: 255767061; 5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp. subtilis str.168)) SEQ ID NO: 76 1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllne gleaifiacg sgefqslsqk 61 eyeqmvevav saaggkvpvy tgvggnlsta ldwaqlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr 301 fpkkaatv (Putative 5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp. subtilis str. RO-NN-1)) SEQ ID NO: 77 1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllne gleaifiacg sgefqslsqk 61 eyeqmvevav saaggkvpvy tgvggnlsta lewaqlsekk gadgylilpp ylvhgeqegl 121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr 301 fpkkaatv (5-dehydro-4-deoxyglucarate dehydratase (Bacillus vallismortis DV1-F-3)) SEQ ID NO: 78 1 mnrirkaptg ilgfpvapfn tqgqleeeal fqniefllee gleaifiacg sgefqslsqk 61 eyeqmvevav saaegkvpvy tgvggnlsta lewarlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsleqi krlteceqlv gvkdgvgnmd lninlvytlg 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyqh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekehyrql eailkqaadr 301 fpkkaatv (5-dehydro-4-deoxyglucarate dehydratase (Bacillus subtilis subsp. spizizenii TU-B-10)) SEQ ID NO: 79 1 msrirkapag ilgfpvapfn tqgkleeeal fqniefllee gleaifiacg sgefqslsqk 61 eyeqmvevai saaggkvpvy tgvggnlsta lewaqlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsveqi krltefeqlv gvkdgvgnmd lninlvytlg 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngd delvkelyqh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqaadr 301 fpkkaatv (ycbC (Bacillus subtilis)) SEQ ID NO: 80 1 msrirkapag ilgfpvapfn tqgtleeeal fqniefllne gleaifiacg sgefqslsqk 61 eyeqmvevav saaggkvpvy tgvggnlsta ldwaqlsekk gadgylilpp ylvhgegegl 121 yqyaktiies tdlnailyqr dnavlsveqi krlteceqlv gvkdgvgnmd lninlvytig 181 drlgwlngmp maevtmpayl pigfhsyssa isnyiphisr mfydalkngn delvkelyrh 241 vilpindirk qrkgyaysli kagmeimgln vrntarppvg pvekdhyqql eailkqpadr 301 fpkkaatv Amino acid transporter LysE (HypE) (NP_743408.1; GI: 26987983; Amino acid transporter LysE (Pseudomonas putida KT2440)) SEQ ID NO: 81 1 maaesyrlqa ldpsrawhrf fatvqqqvek rafgddsseh clrnaqqelt mlgvtdygaf 61 viaflillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava gvatllatyp 121 aafhmvqwag aaylaylglr mllskpggaa htcrmdngqy lrqtmmitll npkaimfyma 181 ffplfvdpvk hqglvtfgfm aatvavvtfl ygliavvlth qlaermrasp rianmferla 241 gaclvgfgik laamr (Amino acid transporter LysE (Pseudomonas putida BIRD-1)) SEQ ID NO: 82 1 mqqqvekraf gddssahclr naqweltmlg vtdygafvia flillaipgp gnfalitatg 61 kggikaglaa tcgvivgdqv llwlavagva tllatypaaf hvvqwagaay laylglrmll 121 skpggaahtc rmdngqylrq tmmitllnpk aimfymaffp lfvdpvkhqg lvtfgfmaat 181 vavvtflygl iavv1thqla ermraspria nmferlagac lvgfgiklaa mr (Amino acid transporter LysE (Pseudomonas putida ND6)) SEQ ID NO: 83 1 mqqqvekrav gddssahclr naqqeltmlg vtdygafvia flillaipgp gnfalitatg 61 kggikaglaa tcgvivgdqv llwlavagva tllatypaaf hmvqwagaay laylglrmll 121 skpggaahtc rmdngqylrq tmmitllnpk aimfymaffp lfvdpvkhqg lvtfgfmaat 181 vavvtflygl iavvlthgla ermranpria nmferlagac lvgfgiklaa mr (Lysine exporter protein LysE/YggA (Pseudomonas putida F1)) SEQ ID NO: 84 1 mlgvtdygaf viaflillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava 61 gvatllatyp aafhmvqwag aaylaylglr mllskpggaa htcrmdngqy lrqtmmitll 121 npkaimfyma ffplfvdpvk hqglvtfgfm aatvavvtfl ygliavvlth qlaermranp 181 rianmferla gaclvgfgik laamr (Unknown (Pseudomonas putida)) SEQ ID NO: 85 1 mlgvtdygaf viafiillai pgpgnfalit atgkggikag laatcgvivg dqvllwlava 61 gvatllatyp aafhivqwag aaylaylglr mllskpgdap rtsrmdngqy lrqtmlitll 121 npkaimfyma ffplfidpvk hqglvtfgfm aatvavitfl ygliavvlth rlaermranp 181 ritnmferla gaclvgfgik laamr PP_1245 (NP_743405.1; GI: 26987980; Hypothetical protein PP_1245 (Pseudomonas putida KT2440)) SEQ ID NO: 86 1 mrptengvlh lrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn 61 gkiaaaliag gigayvgnri ghmldekdqq alalrtqevl sqqqttasaq pvtwksdhsg 121 ataqivpgke ytktkqvevk rapkiqavps mklinepyvt isdnlnvraa pngagekvgs 181 lknhteftav gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask 241 etqgfdldsv qslptqtvaa eaacrpvtvs lksgsgqteq eqntfckqan gtweli (SH3 type 3 domain-containing protein (Pseudomonas putida W619)) SEQ ID NO: 87 1 mrkkfvasll avaiatttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag 61 gigayvgnri ghmldekdqq alalrtqevl sqsatasaqp vtwksdhsga taqitpgkey 121 tqtkkvevkr apkiqavpsm klinepyvti sdnlnvraap nttgekvgsl kshteftavg 181 stgdwilvgr kgvtvgyvhk nyvepkawai akraapavnl ddldvaanke tqgfdldsiq 241 slptetvaae aacrpvtvsl ksgsgqteqe qntfckqang tweli (Hypothetical protein G1E_03180 (Pseudomonas sp. TJI-51)) SEQ ID NO: 88 1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstlgsgn gkiaaaliag 61 gigayvgnri gnmldekdqq alalrtqevl sqqqatasaq pvtwksdhsg asaqivpgke 121 ytktkqvevk rapkiqavps mklinepyvt tsdnlnvraa pnasgekvgs lknhteftav 181 gatgdwilvg rkgvtvgyvh kdyvepkaqa vakrvtpavn ldeldvaask etqafdldsl 241 qslptqtvaa eaacrpvtvs lkaqngkteq eqntfckqan gtweli (SH3 type 3 domain-containing protein (Pseudomonas putida GB-1)) SEQ ID NO: 89 1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag 61 gigayvgnri ghmldekdqq alalrtqevl sqqqatasaq pvtwksdhsg ataqivpgke 121 ytqtkkvevk rapkiqavps mklinepyvt vsdnlnvraa pnqsgekvgs lknhteftav 181 gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask etqgfdldsv 241 qslptetvaa eaacrpvtvs lksgsgqteq eqntfckqan gtweli (SH3 type 3 domain-containing protein (Pseudomonas putida F1)) SEQ ID NO: 90 1 mrkkfvasll avaiasttac aqlgiskeqa gtvigglagv aigstmgsgn gkiaaaliag 61 gigayvgnri ghmldekdqq alalrtqevl sqqqttasaq pvtwksdhsg ataqivpgke 121 ytktkqvevk rapkiqavps mklinepyvt isdnlnvraa pnqagekvgs lknhteftav 181 gstgdwilvg rkgvtvgyvh knyvepkaqa vakrvtpavn ldeldvaask etqgfdldsv 241 qslptqtvaa eaacrpvtvs lksgsgqteg eqntfckgan gtweli PP_1247 (NP_743407.1; GI: 26987982; Hypothetical protein PP_1247 (Pseudomonas putida KT2440)) SEQ ID NO: 91 1 mpicssgwrg lawwdsasnw rrcadpkpds vrarltatlk kppathgsrg lvhsaitqsi 61 gfqliglahe grrkgalafl egvllferav fdqllpdgaf rvavvlglga kvtaprrqpn 121 llaegcelcl gdlllvfaes lfqrfeaava hrvvldlgla gkaahrfsqh rlagvravra 181 nqhraggtle lgfdivqfrq rlevglandf phlgavvavg dherhrafai agaldgevqv 241 drgtkvtgaa dqkragywla hrhvgapgev rrggptiggq lgtwldfvad irhqhdfgpl 301 ggnvrvahlh aqqldmnaai laysvmgqlq rislqvhpgh iaadielvlg parqaffsrt 361 tlyglhgarq aahellgaig lrrrhadlry gyrqvagkrr vgnvplrqhi lkeiallevv 421 vvgqrsllar agdhriatte hqhrcghtan qqlllvhlfd hgvcltgpwr krcssrsrtv 481 grprgss (Uncharacterized protein LOC100789425 (Glycine max)) SEQ ID NO: 92 1 msniafrsti vfllfsavls tppedpikca tsenttctit nsygafpdrs ickaaqvlyp 61 tteqelvsvv asatrnktkm kvatrfshsi pklvopegen gllistkyln kilkvdvetr

121 tmtvesgvtl qqlineaakv glalpyapyw wgltigglmg tgahgstlrg kgsavhdyvv 181 elrivrpagp edgyamvenl neqhedlnaa kvslgvlgvi sqitlklepl fkrsityvak 241 ddsdlggqvv afgdahefad itwypsqhka iyrvddrvpi ntsgnglydf ipfrptpsla 301 svfirtteei qestndangk civastasnt litaaygltn ngiifagypi igfqnrlqss 361 gscldslqda littcawdpr mkglffhqtt fsirlsfvks fiedvqklve lepkglcvlg 421 lyngmlmryv tassaylghq enaldidity yrskdpmtpr lyedileeve qlgifkyggl 481 phwgknrnla fegaikkyks aeyflkvkek ydldglfsst wtdqvlglkd gvtilkdgca 541 leglciclqd shcnpskgyy crpgkvykea rvctnlk PP_1246 (NP_743406.1; GI: 26987981; Hypothetical protein PP_1246 (Pseudomonas putida KT2440)) SEQ ID NO: 93 1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd atswckpqvd ltitrpawdn 61 gellaglitk lpfvfakdcs takvswkavd akgnlyasgs gnasnigivt laaapataap 121 apaaaptptp apapapapap aaaaapavve aapaqakpap apapapapav aaepapapea 181 paaapvvppa papatavaaa ptsdfgrsvv lenrnlmqvt dgtgckwvis tsiigdgdti 241 sfgttpampc pasgfgegsf dkiswkavgt yrgdnwtrvy ahpsglifnk nlepavkdka 301 vsyltpqadq aaflvgeipg rqmkvyltft rssygvlrpf ssdpyyvavt pdesfaldat 361 kykeaaleif dlikttsptt tdvanlfivk dlsaisnniw gndaqkitrn riginrqglf 421 fdvrdganwa vgreqqrvre grqrqqelar vhtrvieryq qlqdgmsdfk gretealaqm 481 agikvrfasp leqqnpatsa svvpmmvhvt gkkgdfysid fpsngrlvad eeysegwyvt 541 qvanatpyyp lddgravpty raysagepea ckqdhcadry sfgavlakef pnagidfswt 601 pevsqqyvnd wnnasamvq (Hypothetical protein TIE_4663 (Pseudomonas putida DOT-T1E)) SEQ ID NO: 94 1 mvienrnimq vtdgtgckwv lstsiigdgd tlsfgttpam pcpasgfgeg sfdkiswkav 61 gtyrgdnwtr vyahpsglif nkhlepavkd kaysyltpqa dqaafivgei pgrqmkvylt 121 ftrssygvlr pfgsdpyyva vtpdesfald atkykeaale ifdlikttsp tttdvanlfi 181 vkdlsaisnn iwgndaqkit rnriginrqg iffdvrdgan wavgreqqry reqrqrqqe1 241 arvhtrvier yqqlqdgmsd fkgreteala qmagikvrfa spleqqnpat sasvvpmmvh 301 vtgkkgdfys idfpsngrlv adeeysegwy vtqvanatpy yplddgravp tyraysagep 361 eackqdhcad rvsfgavlak efpnagidfs wtpevsqqyv ndwnnasamv q (Hypothetical protein YSA_07676 (Pseudomonas putida ND6)) SEQ ID NO: 95 1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd attwckpqvd ltitrpawdn 61 gellsglitk lpfvfakdcs takvswkavd akgnlyasgs gnasnlgivt laaapataap 121 apaaavapap apagpeapaa aaptpapapa papapaaaaa pavveaapaq akpapapapa 181 pavaaepapt peapaaapvv ppapapatav aaaptsdfgr svvienrnlm qvtdgtgckw 241 vlstsiigdg dtlsfgttpa mpcpasgfge gsfdkiswka vgtyrgdnwt rvyahpsgli 301 fnkhlepavk dkaysyltpq adqaafivge ipgrqmkvyl tftrssygvl rpfgsdpyyv 361 avtpdesfal datkykeaal eifdliktts ptttdvanlf ivkdlsaisn niwgndaqki 421 trnriginrq glffdvrdga nwavqreqqr vreqrqrqqe larvhtrvle ryqqlqdgms 481 dfkgreteal aqmagikvrf aspleqqnpa tsasvvpmmv hvtgkkgdfy sidfpsngrl 541 vadeeysegw yvtqvanatp yyplddgrav ptyraysage peackqdhca drvsfgavla 601 kefpnagidf swtpevsqqy vndwnnasam vq (Hypothetical protein Pput_1275 (Pseudomonas putida F1)) SEQ ID NO: 96 1 mkkhalalav igacglvpqa fahelafskk dnikvevpgd attwckpqvd ltitrpawdn 61 qellsglltk lpfvfakdcs takvswkavd akgnlyasgs gnasnlglvt laaapapapa 121 papapapaaa apapaaavap apapagpeap aaaaptpapa papapaaaaa pavveaaaaq 181 akpapapapa pavaaepapt peapaaapvv ppapapatav aaaptsdfgr svvlenrnlm 241 qvtdgtgckw vlstsiigdg dtlsfgttpa mpcpasgfge gsfdkiswka vgtyrgdnwt 301 rvyahpsgli fnknlepavk dkaysyltpq adqaaflvge ipgrqmkvyl tftrssygvl 361 rpfgsdpyyv avtpdesfal datkykeaal eifdliktts ptttdvanlf ivkdlsaisn 421 niwgndaqki trnriginrq glffdvrdga nwavqreqqr vreqrqrqqe larvhtrvle 481 ryqqlqdgms dfkgreteal aqmagikvrf aspleqqnpa tsasvvpmmv hvtgkkgdfy 541 sidfpsngrl vadeeysegw yvtqvanatp yyplddgrav ptyraysage peackqdhca 601 drvsfgavla kefpnagidf swtpevsqqy vndwnnasam vg (Hypothetical protein PputGB1_4145 (Pseudomonas putida GB-1)) SEQ ID NO: 97 1 mkkhalalav vgacglvpqa fahelafskk enikvevpgd aatwckpeve ltitrpawdk 61 qellsglltk lpfvfakdca takvswkavd akgnlyasgs gnatnlglvt avapaaasa 121 apapapapap apapapapap avaalapaap avpapaeapa avaaapapav vepapakaev 181 apapvvaaep apapvaetpv aapvappvpa padavaaapt sdfgravvlq nrnlmqvtdg 241 tgckwvlsts iisdgdtlsf gttpvmpcpa sgfgegsfek iswkavgtyr gdnwtrvyah 301 psglifnknl esavkdkays yltadadqaa flvgeipsrq mkvyltftrs sygvlrpfss 361 dpyyvavtpd esfaldaaky keaaleifdl ikatsptttd vanlfivkdi saitnsmwgn 421 daqkitrnri gitrqglffd vreganwavq reqqrvreer grqqelarvh trvleryqql 481 qdgmsdfkgr etealaqmag ikvrfaspla qqdpatsary apmmvhvtgk kgdfytldfp 541 skgrlvadee ysegwyvtqv anatpyypld dgravptyra ysagepeacq qdhcadrvsf 601 gavlakefpn agidfswtpe vsqkyvndwn nasamvq Alpha-ketoisovalerate decarboxylase (YP_003353820.1; GI: 281491840; Alpha-ketoisovalerate decarboxylase (Lactococcus lactis subsp. lactis KF147)) SEQ ID NO: 98 1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya 61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf 121 khfmkmhepv taartlltae natveidrvl sallkerkpv yinlpvdvaa akaekpslpl 181 kkenptsnts dgeilnkige slknakkpiv itgheiisfg lentvtqfis ktklpittln 241 fgkssvdetl psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm 301 islnidegki fnesiqnfdf eslisslldl sgieykgkyi dkkqedfvps nallsqdrlw 361 qavenitqsn etivaeggts ffgassiflk pkshfiggpl wgsigytfpa algsqiadke 421 srhllfigdg slqltvgelg lairekinpi cfiinndgyt vereihgpnq syndipmwny 481 sklpesfgat eervvskivr tenefvsvmk eaqadpnrmy wielvlaked apkvlkkmgk 541 lfaeqnks (Indole-3-pyruvate decarboxylase (Lactococcus lactis subsp. lactis IO-1)) SEQ ID NO: 99 1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya 61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf 121 khfvkmhepv taartlltae natveidrvl svllkerkpv yinlpvdvaa akaekpslpl 181 kkenpnsnts dgeilnkige slknakkpiv itgheiisfg lektvtqfis ktklpittln 241 fgkssvdeal psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm 301 islninegki fsesiqnfdf eslisslldl sgieykgkyi dkkqenfvps nallsqdrlw 361 qavenitqsn etivaeggts ffgassiflk pkshfiggpl wgsigftfpa algsqiadke 421 srhllfigdg slqltvgelg lairekinpi cfiinndgyt vereihgpnq syndipmwny 481 sklpesfgat edrvvskivr tenefvsvmk eaqadpnrmy wielvlaked apkvlkkmgk 541 lfaeqnks (Branched-chain alpha-ketoacid decarboxylase Lactococcus lactis)) SEQ ID NO: 100 1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisred mkwignanel nasymadgya 61 rtkkaaaflt tfgvgelsai nglagsyaen lpvveivgsp tskvqndgkf vhhtladgdf 121 khfmkmhepv taartlltae natyeidrvl sqllkerkpv yinlpvdvaa akaekpals1 181 ekessttntt eqvilskiee slknaqkpvv iaghevisfg lektvtqfvs etklpittln 241 fgksavdesl psflgiyngk lseislknfv esadfilmlg vkltdsstga fthhldenkm 301 islnidegii fnkvvedfdf ravvsslsel kgieyegqyi dkqyeefips saplsqdrlw 361 qavesltqsn etivaeggts ffgastiflk snsrfiggpl wgsigytfpa algsqiadke 421 srhllfigdg slqltvgelg lsireklnpi cfiinndgyt vereihgptq syndipmwny 481 sklpetfgat edrvvskivr tenefvsvmk eaqadvnrmy wielvleked apkllkkmgk 541 lfaeqnk (Chain A, branched-chain ketoacid decarboxylase (Kdca) (Lactococcus Lactis)) SEQ ID NO: 101 1 mgsshhhhhh ssglvprgsh masmytvgdy lldrlhelgi eeifgvpgdy nlqfldqiis 61 redmkwigna nelnasymad gyartkkaaa flttfgvgel sainglagsy aenlpvveiv 121 gsptskvqnd gkfvhhtlad gdfkhfmkmh epvtaartll taenatyeid rvlsqllker 181 kpvyinlpvd vaaakaekpa lslekesstt ntteqvilsk ieeslknaqk pvviaghevi 241 sfglektvtq fvsetklpit tlnfgksavd eslpsflgiy ngklseislk nfvesadfil 301 mlgvkltdss tgafthhlde nkmislnide giifnkvved fdfravvssl selkgieyeg 361 gyidkgyeef ipssaplsqd rlwqaveslt qsnetivaeg gtsffgasti flksnsrfig 421 qplwgsigyt fpaalgsqia dkesrhllfi gdgslqltvg elglsirekl npicfiinnd 481 gytvereihg ptqsyndipm wnysklpetf gatedrvvsk ivrtenefvs vmkeaqadvn 541 rmywielvle kedapkllkk mgklfaeqnk (Indole-3-pyruvate decarboxylase (Lactococcus lactis subsp. lactis II1403)) SEQ ID NO: 102 1 mytvgdylld rlhelgieei fgvpgdynlq fldqiisrkd mkwvgnanel nasymadgya 61 rtkkaaaflt tfgvgelsav nglagsyaen lpvveivgsp tskvqnegkf vhhtladgdf 121 khfmkmhepv taartlltae natveidrvl sallkerkpv yinlpvdvaa akaekpslp1 181 kkenptsnts dgeilnkige slknakkpiv itgheiisfg lektvtqfis ktklpittln 241 fgkssvdetl psflgiyngk lsepnlkefv esadfilmlg vkltdsstga fthhlnenkm 301 islninegki fnerignfdf eslisslldl sgieykgkyi dkkqedfvps nallsqdrlw 361 qavenitqsn etivaeqgts ffgassiflk pkshfigqpl wgsigytfpa algsqiadke 421 srhllfigd slqltvgerk lqvqvscipss shmnsys Alcohol dehydrogenase yqhD (YP_001459806.1; GI: 157162488; Alcohol dehydrogenase yqhD (Escherichia coli HS)) SEQ ID NO: 103 1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl 61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt

181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase, iron-dependent (Escherichia coli 97.0259)) SEQ ID NO: 104 1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl 61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer iwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase (Escherichia coli MS 200-1)) SEQ ID NO: 105 1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv lnalkgmdvl 61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase yqhD (Escherichia coli B7A)) SEQ ID NO: 106 1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl 61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg heltamhgld haqtlaivlp alwnekretk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar (Alcohol dehydrogenase (Escherichia coli MS 196-1)) SEQ ID NO: 107 1 mnnfnlhtpt rilfgkgaia glreqiphda rvlitygggs vkktgvldqv ldalkgmdvl 61 efggiepnpa yetlmnavkl vreqkvtfll avgggsvldg tkfiaaaany penidpwhil 121 qtggkeiksa ipmgcvltlp atgsesnaga visrkttgdk qafhsahvqp vfavldpvyt 181 ytlpprqvan gvvdafvhtv eqyvtkpvda kiqdrfaegi lltliedgpk alkepenydv 241 ranvmwaatq alngligagv pqdwathmlg hkltamhgld haqtlaivlp alwnekrdtk 301 rakllqyaer vwnitegsdd eridaaiaat rnffeqlgvp thlsdygldg ssipallkkl 361 eehgmtqlge nhditldvsr riyeaar

Sequence CWU 1

1

1601348PRTSulfolobus solfataricus 1Met Glu Asn Val Asn Met Val Lys Ser Lys Ala Ala Leu Leu Lys Lys 1 5 10 15 Phe Ser Glu Pro Leu Ser Ile Glu Asp Val Asn Ile Pro Glu Pro Gln 20 25 30 Gly Glu Glu Val Leu Ile Arg Ile Gly Gly Ala Gly Val Cys Arg Thr 35 40 45 Asp Leu Arg Val Trp Lys Gly Val Glu Ala Lys Gln Gly Phe Arg Leu 50 55 60 Pro Ile Ile Leu Gly His Glu Asn Ala Gly Thr Ile Val Glu Val Gly 65 70 75 80 Glu Leu Ala Lys Val Lys Lys Gly Asp Asn Val Val Val Tyr Ala Thr 85 90 95 Trp Gly Asp Leu Thr Cys Arg Tyr Cys Arg Glu Gly Lys Phe Asn Ile 100 105 110 Cys Lys Asn Gln Ile Ile Pro Gly Gln Thr Thr Asn Gly Gly Phe Ser 115 120 125 Glu Tyr Met Leu Val Lys Ser Ser Arg Trp Leu Val Lys Leu Asn Ser 130 135 140 Leu Ser Pro Val Glu Ala Ala Pro Leu Ala Asp Ala Gly Thr Thr Ser 145 150 155 160 Met Gly Ala Ile Arg Gln Ala Leu Pro Phe Ile Ser Lys Phe Ala Glu 165 170 175 Pro Val Val Ile Val Asn Gly Ile Gly Gly Leu Ala Val Tyr Thr Ile 180 185 190 Gln Ile Leu Lys Ala Leu Met Lys Asn Ile Thr Ile Val Gly Ile Ser 195 200 205 Arg Ser Lys Lys His Arg Asp Phe Ala Leu Glu Leu Gly Ala Asp Tyr 210 215 220 Val Ser Glu Met Lys Asp Ala Glu Ser Leu Ile Asn Lys Leu Thr Asp 225 230 235 240 Gly Leu Gly Ala Ser Ile Ala Ile Asp Leu Val Gly Thr Glu Glu Thr 245 250 255 Thr Tyr Asn Leu Gly Lys Leu Leu Ala Gln Glu Gly Ala Ile Ile Leu 260 265 270 Val Gly Met Glu Gly Lys Arg Val Ser Leu Glu Ala Phe Asp Thr Ala 275 280 285 Val Trp Asn Lys Lys Leu Leu Gly Ser Asn Tyr Gly Ser Leu Asn Asp 290 295 300 Leu Glu Asp Val Val Arg Leu Ser Glu Ser Gly Lys Ile Lys Pro Tyr 305 310 315 320 Ile Ile Lys Val Pro Leu Asp Asp Ile Asn Lys Ala Phe Thr Asn Leu 325 330 335 Asp Glu Gly Arg Val Asp Gly Arg Gln Val Ile Thr 340 345 2344PRTSulfolobus solfataricus 2Met Val Lys Ser Lys Ala Ala Leu Leu Lys Lys Phe Ser Glu Pro Leu 1 5 10 15 Ser Ile Glu Asp Val Asn Ile Pro Glu Pro Gln Gly Glu Glu Val Leu 20 25 30 Ile Arg Ile Gly Gly Ala Gly Val Cys Arg Thr Asp Leu Arg Val Trp 35 40 45 Lys Gly Val Glu Ala Lys Gln Gly Phe Arg Leu Pro Ile Ile Leu Gly 50 55 60 His Glu Asn Ala Gly Thr Ile Val Glu Val Gly Glu Leu Ala Lys Val 65 70 75 80 Lys Lys Gly Asp Asn Val Val Val Tyr Ala Thr Trp Gly Asp Leu Thr 85 90 95 Cys Arg Tyr Cys Arg Glu Gly Lys Phe Asn Ile Cys Lys Asn Gln Ile 100 105 110 Ile Pro Gly Gln Thr Thr Asn Gly Gly Phe Ser Glu Tyr Met Leu Val 115 120 125 Lys Ser Ser Arg Trp Leu Val Lys Leu Asn Ser Leu Ser Pro Val Glu 130 135 140 Ala Ala Pro Leu Ala Asp Ala Gly Thr Thr Ser Met Gly Ala Ile Arg 145 150 155 160 Gln Ala Leu Pro Phe Ile Ser Lys Phe Ala Glu Pro Val Val Ile Val 165 170 175 Asn Gly Ile Gly Gly Leu Ala Val Tyr Thr Ile Gln Ile Leu Lys Ala 180 185 190 Leu Met Lys Asn Ile Thr Ile Val Gly Ile Ser Arg Ser Lys Lys His 195 200 205 Arg Asp Phe Ala Leu Glu Leu Gly Ala Asp Tyr Val Ser Glu Met Lys 210 215 220 Asp Ala Glu Ser Leu Ile Asn Lys Leu Thr Asp Gly Leu Gly Ala Ser 225 230 235 240 Ile Ala Ile Asp Leu Val Gly Thr Glu Glu Thr Thr Tyr Asn Leu Gly 245 250 255 Lys Leu Leu Ala Gln Glu Gly Ala Ile Ile Leu Val Gly Met Glu Gly 260 265 270 Lys Arg Val Ser Leu Glu Ala Phe Asp Thr Ala Val Trp Asn Lys Lys 275 280 285 Leu Leu Gly Ser Asn Tyr Gly Ser Leu Asn Asp Leu Glu Asp Val Val 290 295 300 Arg Leu Ser Glu Ser Gly Lys Ile Lys Pro Tyr Ile Ile Lys Val Pro 305 310 315 320 Leu Asp Asp Ile Asn Lys Ala Phe Thr Asn Leu Asp Glu Gly Arg Val 325 330 335 Asp Gly Arg Gln Val Ile Thr Pro 340 3359PRTSulfolobus islandicus 3Met Phe Gly Ile Thr Phe Tyr Ser Ala Met Arg Lys Asn Ile Ser Met 1 5 10 15 Val Lys Ser Lys Ala Ala Leu Leu Lys Lys Phe Ser Glu Pro Leu Ser 20 25 30 Ile Glu Asp Val Glu Ile Pro Glu Pro Lys Gly Glu Glu Val Leu Val 35 40 45 Arg Ile Gly Gly Ala Gly Val Cys Arg Thr Asp Leu Arg Val Trp Lys 50 55 60 Gly Val Glu Ala Lys Gln Gly Phe Arg Leu Pro Ile Ile Leu Gly His 65 70 75 80 Glu Asn Ala Gly Thr Val Val Glu Val Gly Glu Leu Ala Lys Ala Lys 85 90 95 Lys Gly Asp Asn Val Val Val Tyr Ala Thr Trp Gly Asp Met Thr Cys 100 105 110 Arg Tyr Cys Arg Glu Gly Lys Phe Asn Ile Cys Lys Asn Gln Val Ile 115 120 125 Pro Gly Gln Thr Thr Asn Gly Gly Phe Ser Glu Tyr Met Leu Val Lys 130 135 140 Ser Tyr Arg Trp Leu Val Lys Leu Asp Ser Leu Ser Pro Val Asp Ala 145 150 155 160 Ser Pro Leu Ala Asp Ala Gly Thr Thr Ser Met Gly Ala Ile Arg Gln 165 170 175 Ala Leu Pro Phe Met Asn Lys Phe Ala Glu Pro Val Val Ile Val Asn 180 185 190 Gly Ile Gly Gly Leu Ala Val Tyr Thr Ile Gln Ile Leu Lys Ala Leu 195 200 205 Met Lys Asn Ile Val Ile Val Gly Ile Ser Arg Ser Lys Lys His Arg 210 215 220 Asp Leu Ala Leu Glu Leu Gly Ala Asp Tyr Ala Val Glu Met Lys Glu 225 230 235 240 Ala Glu Ser Leu Ile Ser Lys Leu Thr Asp Gly Leu Gly Ala Ser Val 245 250 255 Ala Ile Asp Leu Val Gly Thr Glu Glu Thr Ser Tyr Asn Leu Gly Lys 260 265 270 Leu Leu Ala Gln Glu Gly Ala Ile Ile Leu Val Gly Met Glu Gly Lys 275 280 285 Arg Val Ser Leu Glu Ala Phe Asp Thr Ala Val Trp Asn Lys Lys Leu 290 295 300 Leu Gly Ser Asn Tyr Gly Ser Leu Asn Asp Leu Glu Asp Val Val Arg 305 310 315 320 Leu Ser Glu Ser Gly Lys Ile Lys Pro Tyr Val Val Lys Ile Pro Leu 325 330 335 Asp Glu Ile Asn Lys Ala Phe Lys Asp Leu Asp Glu Gly Arg Val Glu 340 345 350 Gly Arg Gln Val Ile Thr Pro 355 4359PRTSulfolobus islandicus 4Met Phe Gly Ile Thr Phe Tyr Ser Ala Met Arg Lys Asn Ile Ser Met 1 5 10 15 Val Lys Ser Lys Ala Ala Leu Leu Lys Lys Phe Ser Glu Pro Leu Ser 20 25 30 Ile Glu Asp Val Glu Ile Pro Glu Pro Lys Gly Glu Glu Val Leu Val 35 40 45 Arg Ile Gly Gly Ala Gly Val Cys Arg Thr Asp Leu Arg Val Trp Lys 50 55 60 Gly Val Glu Ala Lys Gln Gly Phe Arg Leu Pro Ile Ile Leu Gly His 65 70 75 80 Glu Asn Ala Gly Thr Val Val Glu Val Gly Glu Leu Ala Lys Ala Lys 85 90 95 Lys Gly Asp Asn Val Val Val Tyr Ala Thr Trp Gly Asp Met Thr Cys 100 105 110 Arg Tyr Cys Arg Glu Gly Lys Phe Asn Ile Cys Lys Asn Gln Val Ile 115 120 125 Pro Gly Gln Thr Thr Asn Gly Gly Phe Ser Glu Tyr Met Leu Val Lys 130 135 140 Ser Tyr Arg Trp Leu Val Lys Leu Asp Ser Leu Ser Pro Val Asp Ala 145 150 155 160 Ser Pro Leu Ala Asp Ala Gly Thr Thr Ser Met Gly Ala Ile Arg Gln 165 170 175 Ala Leu Pro Phe Met Asn Lys Phe Ala Glu Pro Val Val Ile Val Asn 180 185 190 Gly Ile Gly Gly Leu Ala Val Tyr Thr Ile Gln Ile Leu Lys Ala Leu 195 200 205 Met Lys Asn Ile Val Ile Val Gly Ile Ser Arg Ser Arg Lys His Arg 210 215 220 Asp Leu Ala Leu Glu Leu Gly Ala Asp Tyr Ala Val Glu Met Lys Glu 225 230 235 240 Ala Glu Ser Leu Ile Ser Lys Leu Thr Asp Gly Leu Gly Ala Ser Val 245 250 255 Ala Ile Asp Leu Val Gly Thr Glu Glu Thr Ser Tyr Asn Leu Gly Lys 260 265 270 Leu Leu Ala Gln Glu Gly Ala Ile Ile Leu Val Gly Met Glu Gly Lys 275 280 285 Arg Val Ser Leu Glu Ala Phe Asp Thr Ala Val Trp Asn Lys Lys Leu 290 295 300 Leu Gly Ser Asn Tyr Gly Ser Leu Asn Asp Leu Glu Asp Val Val Arg 305 310 315 320 Leu Ser Glu Ser Gly Lys Ile Lys Pro Tyr Val Val Lys Ile Pro Leu 325 330 335 Asp Glu Ile Asn Lys Ala Phe Lys Asp Leu Asp Glu Gly Arg Val Glu 340 345 350 Gly Arg Gln Val Ile Thr Pro 355 5359PRTSulfolobus islandicus 5Met Phe Gly Ile Thr Phe Tyr Ser Ala Met Arg Lys Asn Ile Ser Met 1 5 10 15 Val Lys Ser Lys Ala Ala Leu Leu Lys Lys Phe Ser Glu Pro Leu Ser 20 25 30 Ile Glu Asp Val Glu Ile Pro Glu Pro Lys Gly Glu Glu Val Leu Val 35 40 45 Arg Ile Gly Gly Ala Gly Val Cys Arg Thr Asp Leu Arg Val Trp Lys 50 55 60 Gly Val Glu Ala Lys Gln Gly Phe Arg Leu Pro Ile Ile Leu Gly His 65 70 75 80 Glu Asn Ala Gly Thr Val Val Glu Val Gly Glu Leu Ala Lys Ala Lys 85 90 95 Lys Gly Asp Asn Val Val Val Tyr Ala Thr Trp Gly Asp Met Thr Cys 100 105 110 Arg Tyr Cys Arg Glu Gly Lys Phe Asn Ile Cys Lys Asn Gln Val Ile 115 120 125 Pro Gly Gln Thr Thr Asn Gly Gly Phe Ser Glu Tyr Met Leu Val Lys 130 135 140 Ser Tyr Arg Trp Leu Val Lys Leu Asp Ser Leu Ser Pro Val Asp Ala 145 150 155 160 Ser Pro Leu Ala Asp Ala Gly Thr Thr Ser Met Gly Ala Ile Arg Gln 165 170 175 Ala Leu Pro Phe Met Asn Lys Phe Ala Glu Pro Val Val Ile Val Asn 180 185 190 Gly Ile Gly Gly Leu Ala Val Tyr Thr Ile Gln Ile Leu Lys Ala Leu 195 200 205 Met Lys Asn Ile Val Ile Val Gly Ile Ser Arg Ser Lys Lys His Arg 210 215 220 Asp Leu Ala Leu Glu Leu Gly Ala Asp His Ala Val Glu Met Lys Glu 225 230 235 240 Ala Glu Ser Leu Ile Ser Lys Leu Thr Asp Gly Leu Gly Ala Ser Val 245 250 255 Ala Ile Asp Leu Val Gly Thr Glu Glu Thr Ser Tyr Asn Leu Gly Lys 260 265 270 Leu Leu Ala Gln Glu Gly Ala Ile Ile Leu Val Gly Met Glu Gly Lys 275 280 285 Arg Val Ser Leu Glu Ala Phe Asp Thr Ala Val Trp Asn Lys Lys Leu 290 295 300 Leu Gly Ser Asn Tyr Gly Ser Leu Asn Asp Leu Glu Asp Val Val Arg 305 310 315 320 Leu Ser Glu Ser Gly Lys Ile Lys Pro Tyr Val Val Lys Ile Pro Leu 325 330 335 Asp Glu Ile Asn Lys Ala Phe Lys Asp Leu Asp Glu Gly Arg Val Glu 340 345 350 Gly Arg Gln Val Ile Thr Pro 355 6373PRTSulfolobus solfataricus 6Met Ile Lys Asp Ile Arg Thr Tyr Lys Leu Cys Tyr Glu Gly Ile Asn 1 5 10 15 Asp Glu Arg Asp Ala Leu Ala Ile Lys Gly Leu Ala Glu His Pro Met 20 25 30 Glu Ile Val Ala Thr Glu Ile Glu Thr Ser Asp Gly Tyr Val Gly Tyr 35 40 45 Gly Glu Ser Leu Ala Tyr Gly Cys Ser Asp Ala Val Gln Val Thr Ile 50 55 60 Glu Lys Ile Leu Lys Pro Leu Leu Leu Lys Glu Asp Glu Glu Leu Ile 65 70 75 80 Glu Tyr Leu Trp Asp Lys Met Tyr Lys Ala Thr Leu Arg Phe Gly Arg 85 90 95 Arg Gly Ile Ala Ile Ala Gly Ile Ser Gly Val Asp Thr Ala Leu Trp 100 105 110 Asp Ile Met Gly Lys Lys Ala Lys Lys Pro Ile Tyr Lys Leu Leu Gly 115 120 125 Gly Ser Lys Arg Lys Val Arg Ala Tyr Ile Thr Gly Gly Tyr Tyr Ser 130 135 140 Glu Lys Lys Asp Leu Glu Lys Leu Arg Asp Glu Glu Ala Tyr Tyr Val 145 150 155 160 Lys Met Gly Phe Lys Gly Ile Lys Val Lys Ile Gly Ala Lys Ser Met 165 170 175 Glu Glu Asp Ile Glu Arg Leu Lys Ala Ile Arg Glu Val Val Gly Glu 180 185 190 Asp Val Lys Ile Ala Val Asp Ala Asn Asn Val Tyr Thr Phe Glu Glu 195 200 205 Ala Leu Glu Met Gly Arg Arg Leu Glu Lys Leu Gly Ile Trp Phe Phe 210 215 220 Glu Glu Pro Ile Gln Thr Asp Tyr Leu Asp Leu Ser Ala Arg Leu Ala 225 230 235 240 Glu Glu Leu Glu Val Pro Ile Ala Gly Tyr Glu Thr Ala Tyr Thr Arg 245 250 255 Trp Glu Phe Tyr Glu Ile Met Arg Lys Arg Ala Val Asp Ile Val Gln 260 265 270 Thr Asp Val Met Trp Thr Gly Gly Ile Ser Glu Met Met Lys Ile Gly 275 280 285 Asn Met Ala Lys Val Met Gly Tyr Pro Leu Ile Pro His Tyr Ser Ala 290 295 300 Gly Gly Ile Ser Leu Ile Gly Asn Leu His Val Ala Ala Ala Leu Asn 305 310 315 320 Ser Pro Trp Ile Glu Met His Leu Arg Lys Asn Asp Leu Arg Asp Lys 325 330 335 Ile Phe Lys Glu Ser Ile Glu Ile Asp Asn Gly His Leu Val Val Pro 340 345 350 Asp Arg Pro Gly Leu Gly Tyr Thr Ile Arg Asp Gly Val Phe Glu Glu 355 360 365 Tyr Lys Cys Lys Ser 370 7373PRTSulfolobus islandicus 7Met Ile Lys Asp Ile Arg Thr Tyr Lys Leu Cys Tyr Glu Gly Ile Asn 1 5 10 15 Asp Glu Arg Asp Ala Leu Ala Ile Lys Gly Leu Ala Glu His Pro Met 20 25 30 Glu Ile Val Val Thr Glu Ile Glu Thr Ser Asp Gly Tyr Val Gly Tyr 35 40 45 Gly Glu Ser Leu Ala Tyr Gly Cys Ser Asp Ala Val Gln Val Thr Ile 50 55 60 Glu Lys Ile Leu Lys Pro Leu Leu Leu Lys Glu Asp Glu Glu Leu Ile 65 70 75 80 Glu Tyr Leu Trp Asp Lys Met Tyr Lys Ala Thr Leu Arg Phe Gly Arg 85 90 95 Arg Gly Ile Ala Ile Ala Gly Ile Ser Gly Val Asp Thr Ala Leu Trp 100 105 110 Asp Ile Met Gly Lys Lys Ala Lys Lys Pro Ile Tyr Lys Leu Leu Gly 115 120 125 Gly Ser Lys Arg Lys Val Arg Ala Tyr Ile Thr Gly Gly

Tyr Tyr Ser 130 135 140 Glu Lys Lys Asp Leu Glu Lys Leu Arg Asp Glu Glu Ala Tyr Tyr Val 145 150 155 160 Lys Met Gly Phe Lys Gly Ile Lys Val Lys Ile Gly Ala Lys Ser Met 165 170 175 Glu Glu Asp Ile Glu Arg Leu Lys Ala Ile Arg Glu Val Val Gly Glu 180 185 190 Asp Val Lys Ile Ala Val Asp Ala Asn Asn Val Tyr Thr Phe Glu Glu 195 200 205 Ala Leu Glu Met Gly Arg Arg Leu Glu Lys Leu Gly Ile Trp Phe Phe 210 215 220 Glu Glu Pro Ile Gln Thr Asp Tyr Leu Asp Leu Ser Ala Arg Leu Ala 225 230 235 240 Glu Glu Leu Glu Val Pro Ile Ala Gly Tyr Glu Thr Ala Tyr Thr Arg 245 250 255 Trp Glu Phe Tyr Glu Ile Met Arg Lys Arg Ala Val Asp Ile Val Gln 260 265 270 Thr Asp Val Met Trp Thr Gly Gly Ile Ser Glu Met Met Lys Ile Gly 275 280 285 Asn Met Ala Lys Val Met Gly Tyr Pro Leu Ile Pro His Tyr Ser Ala 290 295 300 Gly Gly Ile Ser Leu Ile Gly Asn Leu His Val Ala Ala Ala Leu Asn 305 310 315 320 Ser Pro Trp Ile Glu Met His Leu Arg Lys Asn Asp Leu Arg Asp Lys 325 330 335 Ile Phe Lys Glu Ser Ile Glu Ile Asp Asn Gly His Leu Val Val Pro 340 345 350 Asp Arg Pro Gly Leu Gly Tyr Thr Ile Arg Asp Gly Val Phe Glu Glu 355 360 365 Tyr Lys Cys Lys Ser 370 8373PRTSulfolobus islandicus 8Met Ile Lys Asp Ile Arg Thr Tyr Lys Leu Cys Tyr Glu Gly Ile Asn 1 5 10 15 Asp Glu Arg Asp Ala Leu Ala Ile Lys Gly Leu Ala Glu His Pro Met 20 25 30 Glu Ile Val Val Thr Glu Ile Glu Thr Ser Asp Gly Tyr Val Gly Tyr 35 40 45 Gly Glu Ser Leu Ala Tyr Gly Cys Ser Asp Ala Val Gln Val Thr Ile 50 55 60 Glu Lys Ile Leu Lys Pro Leu Leu Leu Lys Glu Asp Glu Glu Phe Ile 65 70 75 80 Glu Tyr Leu Trp Asp Lys Met Tyr Lys Ala Thr Leu Arg Phe Gly Arg 85 90 95 Arg Gly Ile Ala Ile Ala Gly Ile Ser Gly Val Asp Thr Ala Leu Trp 100 105 110 Asp Ile Met Gly Lys Lys Ala Lys Lys Pro Ile Tyr Lys Leu Leu Gly 115 120 125 Gly Ser Lys Arg Lys Val Arg Ala Tyr Ile Thr Gly Gly Tyr Tyr Ser 130 135 140 Glu Lys Lys Asp Leu Glu Lys Leu Arg Asp Glu Glu Ala Tyr Tyr Val 145 150 155 160 Lys Met Gly Phe Lys Gly Ile Lys Val Lys Ile Gly Ala Lys Ser Met 165 170 175 Glu Glu Asp Ile Glu Arg Leu Lys Ala Ile Arg Glu Val Val Gly Glu 180 185 190 Asp Val Lys Ile Ala Val Asp Ala Asn Asn Val Tyr Thr Phe Glu Glu 195 200 205 Ala Leu Glu Met Gly Arg Arg Leu Glu Lys Leu Gly Ile Trp Phe Phe 210 215 220 Glu Glu Pro Ile Gln Thr Asp Tyr Leu Asp Leu Ser Ala Arg Leu Ala 225 230 235 240 Glu Glu Leu Glu Val Pro Ile Ala Gly Tyr Glu Thr Ala Tyr Thr Arg 245 250 255 Trp Glu Phe Tyr Glu Ile Met Arg Lys Arg Ala Val Asp Ile Val Gln 260 265 270 Thr Asp Val Met Trp Thr Gly Gly Ile Ser Glu Met Met Lys Ile Gly 275 280 285 Asn Met Ala Lys Val Met Gly Tyr Ser Leu Ile Pro His Tyr Ser Ala 290 295 300 Gly Gly Ile Ser Leu Ile Gly Asn Leu His Val Ala Ala Ala Leu Asn 305 310 315 320 Ser Pro Trp Ile Glu Met His Leu Arg Lys Asn Asp Leu Arg Asp Lys 325 330 335 Ile Phe Lys Glu Ser Ile Glu Ile Asp Asn Gly His Leu Val Val Pro 340 345 350 Asp Arg Pro Gly Leu Gly Tyr Thr Ile Arg Asp Gly Val Phe Glu Glu 355 360 365 Tyr Lys Cys Lys Ser 370 9373PRTSulfolobus islandicus 9Met Ile Lys Asp Ile Arg Thr Tyr Lys Leu Cys Tyr Glu Gly Ile Asn 1 5 10 15 Asp Glu Arg Asp Ala Leu Ala Ile Lys Gly Leu Ala Glu His Pro Met 20 25 30 Glu Ile Val Val Thr Glu Ile Glu Thr Ser Asp Gly Tyr Val Gly Tyr 35 40 45 Gly Glu Ser Leu Ala Tyr Gly Cys Ser Asp Ala Val Gln Val Thr Ile 50 55 60 Glu Lys Ile Leu Lys Pro Leu Leu Leu Lys Glu Asp Glu Glu Leu Ile 65 70 75 80 Glu Tyr Leu Trp Asp Lys Met Tyr Lys Ala Thr Leu Arg Phe Gly Arg 85 90 95 Arg Gly Ile Ala Ile Ala Gly Ile Ser Gly Val Asp Thr Gly Leu Trp 100 105 110 Asp Ile Met Gly Lys Lys Ala Lys Lys Pro Ile Tyr Lys Leu Leu Gly 115 120 125 Gly Ser Lys Arg Lys Val Arg Ala Tyr Ile Thr Gly Gly Tyr Tyr Ser 130 135 140 Glu Lys Lys Asp Leu Glu Lys Leu Arg Asp Glu Glu Ala Tyr Tyr Val 145 150 155 160 Lys Met Gly Phe Lys Gly Ile Lys Val Lys Ile Gly Ala Lys Ser Met 165 170 175 Glu Glu Asp Ile Glu Arg Leu Lys Ala Ile Arg Glu Val Val Gly Glu 180 185 190 Asp Val Lys Ile Ala Val Asp Ala Asn Asn Val Tyr Thr Phe Glu Glu 195 200 205 Ala Leu Glu Met Gly Arg Arg Leu Glu Lys Leu Gly Ile Trp Phe Phe 210 215 220 Glu Glu Pro Ile Gln Thr Asp Tyr Leu Asp Leu Ser Ala Arg Leu Ala 225 230 235 240 Glu Glu Leu Glu Val Pro Ile Ala Gly Tyr Glu Thr Ala Tyr Thr Arg 245 250 255 Trp Glu Phe Tyr Glu Ile Met Arg Lys Arg Ala Val Asp Ile Val Gln 260 265 270 Thr Asp Val Met Trp Thr Gly Gly Ile Ser Glu Met Met Lys Ile Gly 275 280 285 Asn Met Ala Lys Val Met Gly Tyr Pro Leu Ile Pro His Tyr Ser Ala 290 295 300 Gly Gly Ile Ser Leu Ile Gly Asn Leu His Val Ala Ala Ala Leu Asn 305 310 315 320 Ser Pro Trp Ile Glu Met His Leu Arg Lys Asn Asp Leu Arg Asp Lys 325 330 335 Ile Phe Lys Glu Ser Ile Glu Ile Asp Asn Gly His Leu Val Val Pro 340 345 350 Asp Arg Pro Gly Leu Gly Tyr Thr Ile Arg Asp Gly Val Phe Glu Glu 355 360 365 Tyr Lys Cys Lys Ser 370 10373PRTSulfolobus islandicus 10Met Ile Lys Asp Ile Arg Thr Tyr Lys Leu Cys Tyr Glu Gly Ile Asn 1 5 10 15 Asp Glu Arg Asp Ala Leu Ala Ile Lys Gly Leu Ala Glu His Pro Met 20 25 30 Glu Ile Val Val Thr Glu Ile Glu Thr Ser Asp Gly Tyr Val Gly Tyr 35 40 45 Gly Glu Ser Leu Ala Tyr Gly Cys Ser Asp Ala Val Gln Val Thr Ile 50 55 60 Glu Lys Ile Leu Lys Pro Leu Leu Leu Lys Glu Asp Glu Glu Leu Ile 65 70 75 80 Glu Tyr Leu Trp Asp Lys Met Tyr Lys Ala Thr Leu Arg Phe Gly Arg 85 90 95 Arg Gly Ile Ala Ile Ala Gly Ile Ser Gly Val Asp Thr Ala Leu Trp 100 105 110 Asp Ile Met Gly Lys Lys Ala Lys Lys Pro Ile Tyr Lys Leu Leu Gly 115 120 125 Gly Ser Lys Arg Lys Val Arg Ala Tyr Ile Thr Gly Gly Tyr Tyr Ser 130 135 140 Glu Lys Lys Asp Leu Glu Lys Leu Arg Asp Glu Glu Ala Tyr Tyr Val 145 150 155 160 Lys Met Gly Phe Lys Gly Ile Lys Ile Lys Ile Gly Ala Lys Ser Met 165 170 175 Glu Glu Asp Ile Glu Arg Leu Lys Ala Ile Arg Glu Val Val Gly Glu 180 185 190 Asp Val Lys Ile Ala Val Asp Ala Asn Asn Val Tyr Thr Phe Glu Glu 195 200 205 Ala Leu Glu Met Gly Arg Arg Leu Glu Lys Leu Gly Ile Trp Phe Phe 210 215 220 Glu Glu Pro Ile Gln Thr Asp Tyr Leu Asp Leu Ser Ala Arg Leu Ala 225 230 235 240 Glu Glu Leu Glu Val Pro Ile Ala Gly Tyr Glu Thr Ala Tyr Thr Arg 245 250 255 Trp Glu Phe Tyr Glu Ile Met Arg Lys Arg Ala Val Asp Ile Val Gln 260 265 270 Thr Asp Val Met Trp Thr Gly Gly Ile Ser Glu Met Met Lys Ile Gly 275 280 285 Asn Met Ala Lys Val Met Gly Tyr Pro Leu Ile Pro His Tyr Ser Ala 290 295 300 Gly Gly Ile Ser Leu Ile Gly Asn Leu His Val Ala Ala Ala Leu Asn 305 310 315 320 Ser Pro Trp Ile Glu Met His Leu Arg Lys Asn Asp Leu Arg Asp Lys 325 330 335 Ile Phe Lys Glu Ser Ile Glu Ile Asp Asn Gly His Leu Val Val Pro 340 345 350 Asp Arg Pro Gly Leu Gly Tyr Thr Ile Arg Asp Gly Val Phe Glu Glu 355 360 365 Tyr Lys Cys Lys Ser 370 11298PRTSulfolobus solfataricus 11Met His Phe Ile Met Met Lys Leu Phe Arg Val Val Lys Arg Gly Tyr 1 5 10 15 Tyr Ile Ser Tyr Ala Ile Leu Asp Asn Ser Thr Ile Ile Arg Leu Asp 20 25 30 Glu Asp Pro Ile Lys Ala Leu Met Arg Tyr Ser Glu Asn Lys Glu Val 35 40 45 Leu Gly Asp Arg Val Thr Gly Ile Asp Tyr Gln Ser Leu Leu Lys Ser 50 55 60 Phe Gln Ile Asn Asp Ile Arg Ile Thr Lys Pro Ile Asp Pro Pro Glu 65 70 75 80 Val Trp Gly Ser Gly Ile Ser Tyr Glu Met Ala Arg Glu Arg Tyr Ser 85 90 95 Glu Glu Asn Val Ala Lys Ile Leu Gly Lys Thr Ile Tyr Glu Lys Val 100 105 110 Tyr Asp Ala Val Arg Pro Glu Ile Phe Phe Lys Ala Thr Pro Asn Arg 115 120 125 Cys Val Gly His Gly Glu Ala Ile Ala Val Arg Ser Asp Ser Glu Trp 130 135 140 Thr Leu Pro Glu Pro Glu Leu Ala Val Val Leu Asp Ser Asn Gly Lys 145 150 155 160 Ile Leu Gly Tyr Thr Ile Met Asp Asp Val Ser Ala Arg Asp Leu Glu 165 170 175 Ala Glu Asn Pro Leu Tyr Leu Pro Gln Ser Lys Ile Tyr Ala Gly Cys 180 185 190 Cys Ala Phe Gly Pro Val Ile Val Thr Ser Asp Glu Ile Lys Asn Pro 195 200 205 Tyr Ser Leu Asp Ile Thr Leu Lys Ile Val Arg Glu Gly Arg Val Phe 210 215 220 Phe Glu Gly Ser Val Asn Thr Asn Lys Met Arg Arg Lys Ile Glu Glu 225 230 235 240 Gln Ile Gln Tyr Leu Ile Arg Asp Asn Pro Ile Pro Asp Gly Thr Ile 245 250 255 Leu Thr Thr Gly Thr Ala Ile Val Pro Gly Arg Asp Lys Gly Leu Lys 260 265 270 Asp Glu Asp Ile Val Glu Ile Thr Ile Ser Asn Ile Gly Thr Leu Ile 275 280 285 Thr Pro Val Lys Lys Arg Arg Lys Ile Thr 290 295 12311PRTSulfolobus islandicus 12Met Leu Thr Cys Leu Leu Pro Thr Leu Leu Tyr Ala Lys Cys Ile Phe 1 5 10 15 Ile Met Met Lys Leu Phe Arg Val Val Lys Arg Gly Tyr Tyr Ile Ser 20 25 30 Tyr Ala Ile Leu Asp Asn Ser Thr Ile Ile Arg Leu Asp Glu Asp Pro 35 40 45 Ile Lys Ala Leu Met Arg Tyr Ser Glu Asn Lys Glu Val Leu Gly Asp 50 55 60 Arg Val Thr Gly Ile Asp Tyr Gln Ser Leu Leu Lys Ser Phe Gln Ile 65 70 75 80 Asn Asp Ile Arg Ile Thr Lys Pro Ile Asp Pro Pro Glu Val Trp Gly 85 90 95 Ser Gly Ile Ser Tyr Glu Met Ala Arg Glu Arg Tyr Ser Glu Glu Asn 100 105 110 Val Ala Lys Ile Leu Gly Lys Thr Ile Tyr Glu Lys Val Tyr Asp Ala 115 120 125 Val Arg Pro Glu Ile Phe Phe Lys Ala Thr Pro Asn Arg Cys Val Gly 130 135 140 His Gly Glu Ala Ile Ala Val Arg Ser Asp Ser Glu Trp Thr Leu Pro 145 150 155 160 Glu Pro Glu Leu Ala Val Val Leu Asp Ser Asn Gly Lys Ile Leu Gly 165 170 175 Tyr Thr Ile Met Asp Asp Val Ser Ala Arg Asp Leu Glu Ala Glu Asn 180 185 190 Pro Leu Tyr Leu Pro Gln Ser Lys Ile Tyr Ala Gly Cys Cys Ala Phe 195 200 205 Gly Pro Val Ile Val Thr Ser Asp Glu Ile Lys Asn Pro Tyr Ser Leu 210 215 220 Asp Ile Thr Leu Lys Ile Val Arg Glu Gly Arg Val Phe Phe Glu Gly 225 230 235 240 Ser Val Asn Thr Asn Lys Met Arg Arg Lys Ile Glu Glu Gln Ile Gln 245 250 255 Tyr Leu Ile Arg Asp Asn Pro Ile Pro Asp Gly Thr Ile Leu Thr Thr 260 265 270 Gly Thr Ala Ile Val Pro Gly Arg Asp Lys Gly Leu Lys Asp Glu Asp 275 280 285 Ile Val Glu Ile Thr Ile Ser Asn Ile Gly Thr Leu Ile Thr Pro Val 290 295 300 Lys Lys Arg Arg Lys Ile Thr 305 310 13294PRTSulfolobus solfataricus 13Met Met Lys Leu Phe Arg Val Val Lys Arg Gly Tyr Tyr Ile Ser Tyr 1 5 10 15 Ala Ile Leu Asp Asn Ser Thr Ile Ile Arg Leu Asp Glu Asp Pro Ile 20 25 30 Lys Ala Leu Met Arg Tyr Ser Glu Asn Lys Glu Val Leu Gly Asp Arg 35 40 45 Val Thr Gly Ile Asp Tyr Gln Ser Leu Leu Lys Ser Phe Gln Ile Asn 50 55 60 Asp Ile Arg Ile Thr Lys Pro Ile Asp Pro Pro Glu Val Trp Gly Ser 65 70 75 80 Gly Ile Ser Tyr Glu Met Ala Arg Glu Arg Tyr Ser Glu Glu Asn Val 85 90 95 Ala Lys Ile Leu Gly Lys Thr Ile Tyr Glu Lys Val Tyr Asp Ala Val 100 105 110 Arg Pro Glu Ile Phe Phe Lys Ala Thr Pro Asn Arg Cys Val Gly His 115 120 125 Gly Glu Ala Ile Ala Val Arg Ser Asp Ser Glu Trp Thr Leu Pro Glu 130 135 140 Pro Glu Leu Ala Val Val Leu Asp Ser Asn Gly Lys Ile Leu Gly Tyr 145 150 155 160 Thr Ile Met Asp Asp Val Ser Ala Arg Asp Leu Glu Ala Glu Asn Pro 165 170 175 Leu Tyr Leu Pro Gln Ser Lys Ile Tyr Ala Gly Cys Cys Ala Phe Gly 180 185 190 Pro Val Ile Val Thr Ser Asp Glu Ile Lys Asn Pro Tyr Ser Leu Asp 195 200 205 Ile Thr Leu Lys Ile Val Arg Glu Gly Arg Val Phe Phe Glu Gly Ser 210 215 220 Val Asn Thr Asn Lys Met Arg Arg Lys Ile Glu Glu Gln Ile Gln Tyr 225 230 235 240 Leu Ile Arg Asp Asn Pro Ile Pro Asp Gly Thr Ile Leu Thr Thr Gly 245 250 255 Thr Ala Ile Val Pro Gly Arg Asp Lys Gly Leu Lys Asp Glu Asp Ile 260 265 270 Val Glu Ile Thr Ile Ser Asn Ile Gly Thr Leu Ile Thr Pro Val Lys 275 280 285 Lys Arg Arg Lys Ile Thr 290 14293PRTSulfolobus solfataricus 14Met Lys Leu Phe Arg Val Val Lys Arg Gly Tyr Tyr Ile Ser Tyr Ala 1 5 10 15

Ile Leu Asp Asn Ser Thr Ile Ile Arg Leu Asp Glu Asp Pro Ile Lys 20 25 30 Ala Leu Met Arg Tyr Ser Glu Asn Lys Glu Val Leu Gly Asp Arg Val 35 40 45 Thr Gly Ile Asp Tyr Gln Ser Leu Leu Lys Ser Phe Gln Ile Asn Asp 50 55 60 Ile Arg Ile Thr Lys Pro Ile Asp Pro Pro Glu Val Trp Gly Ser Gly 65 70 75 80 Ile Ser Tyr Glu Met Ala Arg Glu Arg Tyr Ser Glu Glu Asn Val Ala 85 90 95 Lys Ile Leu Gly Lys Thr Ile Tyr Glu Lys Val Tyr Asp Ala Val Arg 100 105 110 Pro Glu Ile Phe Phe Lys Ala Thr Pro Asn Arg Cys Val Gly His Gly 115 120 125 Glu Ala Ile Ala Val Arg Ser Asp Ser Glu Trp Thr Leu Pro Glu Pro 130 135 140 Glu Leu Ala Val Val Leu Asp Ser Asn Gly Lys Ile Leu Gly Tyr Thr 145 150 155 160 Ile Met Asp Asp Val Ser Ala Arg Asp Leu Glu Ala Glu Asn Pro Leu 165 170 175 Tyr Leu Pro Gln Ser Lys Ile Tyr Ala Gly Cys Cys Ala Phe Gly Pro 180 185 190 Val Ile Val Thr Ser Asp Glu Ile Lys Asn Pro Tyr Ser Leu Asp Ile 195 200 205 Thr Leu Lys Ile Val Arg Glu Gly Arg Val Phe Phe Glu Gly Ser Val 210 215 220 Asn Thr Asn Lys Met Arg Arg Lys Ile Glu Glu Gln Ile Gln Tyr Leu 225 230 235 240 Ile Arg Asp Asn Pro Ile Pro Asp Gly Thr Ile Leu Thr Thr Gly Thr 245 250 255 Ala Ile Val Pro Gly Arg Asp Lys Gly Leu Lys Asp Glu Asp Ile Val 260 265 270 Glu Ile Thr Ile Ser Asn Ile Gly Thr Leu Ile Thr Pro Val Lys Lys 275 280 285 Arg Arg Lys Ile Thr 290 15294PRTSulfolobus islandicus 15Met Met Lys Leu Phe Arg Val Val Lys Arg Gly Tyr Tyr Ile Ser Tyr 1 5 10 15 Ala Ile Leu Asp Asn Ser Thr Ile Ile Arg Leu Asp Glu Asp Pro Ile 20 25 30 Lys Ala Leu Met Arg Tyr Ser Glu Asn Lys Glu Val Leu Gly Asp Arg 35 40 45 Val Thr Gly Ile Asp Tyr Gln Ser Leu Leu Lys Ser Phe Gln Ile Asn 50 55 60 Asp Ile Arg Ile Thr Lys Pro Ile Asp Pro Pro Glu Val Trp Gly Ser 65 70 75 80 Gly Ile Ser Tyr Glu Met Ala Arg Glu Arg Tyr Ser Glu Glu Asn Val 85 90 95 Ala Lys Ile Leu Gly Lys Thr Ile Tyr Glu Lys Val Tyr Asp Ala Val 100 105 110 Arg Pro Glu Ile Phe Phe Lys Ala Thr Pro Asn Arg Cys Val Gly His 115 120 125 Gly Glu Ala Ile Ala Val Arg Ser Asp Ser Glu Trp Thr Leu Pro Glu 130 135 140 Pro Glu Leu Ala Val Val Leu Asp Ser Asn Gly Lys Ile Leu Gly Tyr 145 150 155 160 Thr Ile Met Asp Asp Val Ser Ala Arg Asp Leu Glu Ala Glu Asn Pro 165 170 175 Leu Tyr Leu Pro Gln Ser Lys Ile Tyr Ala Gly Cys Cys Ala Phe Gly 180 185 190 Pro Val Ile Val Thr Ser Asp Glu Ile Lys Asn Pro Tyr Ser Leu Asp 195 200 205 Ile Thr Leu Lys Ile Val Arg Lys Asp Arg Val Phe Phe Glu Gly Ser 210 215 220 Val Asn Thr Asn Lys Met Arg Arg Lys Ile Glu Glu Gln Ile Gln Tyr 225 230 235 240 Leu Ile Arg Asp Asn Pro Ile Pro Asp Gly Thr Ile Leu Thr Thr Gly 245 250 255 Thr Ala Ile Val Pro Gly Arg Asp Lys Gly Leu Lys Asp Glu Asp Ile 260 265 270 Val Glu Ile Thr Ile Ser Asn Ile Gly Thr Leu Ile Thr Pro Val Lys 275 280 285 Lys Arg Arg Lys Ile Thr 290 16478PRTSulfolobus solfataricus 16Met Lys Ser Tyr Gln Gly Leu Ala Asp Lys Trp Ile Lys Gly Ser Gly 1 5 10 15 Glu Glu Tyr Leu Asp Ile Asn Pro Ala Asp Lys Asp His Val Leu Ala 20 25 30 Lys Ile Arg Leu Tyr Thr Lys Asp Asp Val Lys Glu Ala Ile Asn Lys 35 40 45 Ala Val Ala Lys Phe Asp Glu Trp Ser Arg Thr Pro Ala Pro Lys Arg 50 55 60 Gly Ser Ile Leu Leu Lys Ala Gly Glu Leu Met Glu Gln Glu Ala Gln 65 70 75 80 Glu Phe Ala Leu Leu Met Thr Leu Glu Glu Gly Lys Thr Leu Lys Asp 85 90 95 Ser Met Phe Glu Val Thr Arg Ser Tyr Asn Leu Leu Lys Phe Tyr Gly 100 105 110 Ala Leu Ala Phe Lys Ile Ser Gly Lys Thr Leu Pro Ser Ala Asp Pro 115 120 125 Asn Thr Arg Ile Phe Thr Val Lys Glu Pro Leu Gly Val Val Ala Leu 130 135 140 Ile Thr Pro Trp Asn Phe Pro Leu Ser Ile Pro Val Trp Lys Leu Ala 145 150 155 160 Pro Ala Leu Ala Ala Gly Asn Thr Ala Val Ile Lys Pro Ala Thr Lys 165 170 175 Thr Pro Leu Met Val Ala Lys Leu Val Glu Val Leu Ser Lys Ala Gly 180 185 190 Leu Pro Glu Gly Val Val Asn Leu Val Val Gly Lys Gly Ser Glu Val 195 200 205 Gly Asp Thr Ile Val Ser Asp Asp Asn Ile Ala Ala Val Ser Phe Thr 210 215 220 Gly Ser Thr Glu Val Gly Lys Arg Ile Tyr Lys Leu Val Gly Asn Lys 225 230 235 240 Asn Arg Met Thr Arg Ile Gln Leu Glu Leu Gly Gly Lys Asn Ala Leu 245 250 255 Tyr Val Asp Lys Ser Ala Asp Leu Thr Leu Ala Ala Glu Leu Ala Val 260 265 270 Arg Gly Gly Phe Gly Leu Thr Gly Gln Ser Cys Thr Ala Thr Ser Arg 275 280 285 Leu Ile Ile Asn Lys Asp Val Tyr Thr Gln Phe Lys Gln Arg Leu Leu 290 295 300 Glu Arg Val Lys Lys Trp Arg Val Gly Pro Gly Thr Glu Asp Val Asp 305 310 315 320 Met Gly Pro Val Val Asp Glu Gly Gln Phe Lys Lys Asp Leu Glu Tyr 325 330 335 Ile Glu Tyr Gly Lys Asn Val Gly Ala Lys Leu Ile Tyr Gly Gly Asn 340 345 350 Ile Ile Pro Gly Lys Gly Tyr Phe Leu Glu Pro Thr Ile Phe Glu Gly 355 360 365 Val Thr Ser Asp Met Arg Leu Phe Lys Glu Glu Ile Phe Gly Pro Val 370 375 380 Leu Ser Val Thr Glu Ala Lys Asp Leu Asp Glu Ala Ile Arg Leu Val 385 390 395 400 Asn Ala Val Asp Tyr Gly His Thr Ala Gly Ile Val Ala Ser Asp Ile 405 410 415 Lys Ala Ile Asn Glu Phe Val Ser Arg Val Glu Ala Gly Val Ile Lys 420 425 430 Val Asn Lys Pro Thr Val Gly Leu Glu Leu Gln Ala Pro Phe Gly Gly 435 440 445 Phe Lys Asn Ser Gly Ala Thr Thr Trp Lys Glu Met Gly Glu Asp Ala 450 455 460 Leu Glu Phe Tyr Leu Lys Glu Lys Thr Val Tyr Glu Gly Trp 465 470 475 17478PRTSulfolobus islandicus 17Met Lys Ser Tyr Gln Gly Leu Ala Asp Lys Trp Ile Lys Gly Ser Gly 1 5 10 15 Glu Glu Tyr Leu Asp Ile Asn Pro Ala Asp Lys Asp His Val Leu Ala 20 25 30 Lys Ile Arg Leu Tyr Thr Lys Asp Asp Val Lys Glu Ala Ile Asn Lys 35 40 45 Ala Val Ala Lys Phe Asp Glu Trp Ser Arg Thr Pro Ala Pro Lys Arg 50 55 60 Gly Ser Ile Leu Leu Lys Ala Gly Glu Leu Met Glu Gln Glu Ala Gln 65 70 75 80 Glu Phe Ala Leu Leu Met Thr Leu Glu Glu Gly Lys Thr Leu Lys Asp 85 90 95 Ser Met Phe Glu Val Thr Arg Ser Tyr Asn Leu Leu Lys Phe Tyr Gly 100 105 110 Ala Leu Gly Phe Lys Ile Ser Gly Lys Thr Leu Pro Ser Ala Asp Pro 115 120 125 Asn Thr Arg Ile Phe Thr Val Lys Glu Pro Leu Gly Val Val Ala Leu 130 135 140 Ile Thr Pro Trp Asn Phe Pro Leu Ser Ile Pro Val Trp Lys Leu Ala 145 150 155 160 Pro Ala Leu Ala Ala Gly Asn Thr Ala Val Ile Lys Pro Ala Thr Lys 165 170 175 Thr Pro Leu Met Val Ala Lys Leu Val Glu Val Leu Ser Lys Ala Gly 180 185 190 Leu Pro Glu Gly Val Val Asn Leu Val Val Gly Lys Gly Ser Glu Val 195 200 205 Gly Asp Thr Ile Val Ser Asp Asp Asn Ile Ala Ala Val Ser Phe Thr 210 215 220 Gly Ser Thr Glu Val Gly Lys Arg Ile Tyr Lys Leu Val Gly Asn Lys 225 230 235 240 Asn Arg Met Thr Arg Ile Gln Leu Glu Leu Gly Gly Lys Asn Ala Leu 245 250 255 Tyr Val Asp Lys Ser Ala Asp Leu Thr Leu Ala Ala Glu Leu Ala Val 260 265 270 Arg Gly Gly Phe Gly Leu Thr Gly Gln Ser Cys Thr Ala Thr Ser Arg 275 280 285 Leu Ile Ile His Lys Asp Val Tyr Thr Gln Phe Lys Gln Arg Leu Leu 290 295 300 Glu Arg Val Lys Lys Trp Arg Val Gly Pro Gly Thr Glu Asp Val Asp 305 310 315 320 Met Gly Pro Val Val Asp Glu Gly Gln Phe Lys Lys Asp Leu Glu Tyr 325 330 335 Ile Glu Tyr Gly Lys Asn Ala Gly Ala Lys Leu Ile Tyr Gly Gly Asn 340 345 350 Ile Ile Pro Gly Lys Gly Tyr Phe Leu Glu Pro Thr Ile Phe Glu Gly 355 360 365 Val Thr Ser His Met Arg Leu Phe Lys Glu Glu Ile Phe Gly Pro Val 370 375 380 Leu Ser Val Thr Glu Ala Lys Asp Leu Asp Glu Ala Ile Arg Leu Val 385 390 395 400 Asn Ala Val Asp Tyr Gly His Thr Ala Gly Ile Val Ala Ser Asp Ile 405 410 415 Lys Ala Ile Asn Glu Phe Val Ser Arg Val Glu Ala Gly Val Ile Lys 420 425 430 Val Asn Lys Pro Thr Val Gly Leu Glu Leu Gln Ala Pro Phe Gly Gly 435 440 445 Phe Lys Asn Ser Gly Ala Thr Thr Trp Lys Glu Met Gly Glu Asp Ala 450 455 460 Leu Glu Phe Tyr Leu Lys Glu Lys Thr Val Tyr Glu Gly Trp 465 470 475 18478PRTSulfolobus islandicus 18Met Lys Ser Tyr Gln Gly Leu Ala Asp Lys Trp Ile Lys Gly Ser Gly 1 5 10 15 Glu Glu Tyr Leu Asp Ile Asn Pro Ala Asp Lys Asp His Val Leu Ala 20 25 30 Lys Ile Arg Leu Tyr Thr Lys Asp Asp Val Lys Glu Ala Ile Asn Lys 35 40 45 Ala Val Ala Lys Phe Asp Glu Trp Ser Arg Thr Pro Ala Pro Lys Arg 50 55 60 Gly Ser Ile Leu Leu Lys Ala Gly Glu Leu Met Glu Gln Glu Ala Gln 65 70 75 80 Glu Phe Ala Leu Leu Met Thr Leu Glu Glu Gly Lys Thr Leu Lys Asp 85 90 95 Ser Met Phe Glu Val Thr Arg Ser Tyr Asn Leu Leu Lys Phe Tyr Gly 100 105 110 Ala Leu Ala Phe Lys Ile Ser Gly Lys Thr Leu Pro Ser Ala Asp Pro 115 120 125 Asn Thr Arg Ile Phe Thr Val Lys Glu Pro Leu Gly Val Val Ala Leu 130 135 140 Ile Thr Pro Trp Asn Phe Pro Leu Ser Ile Pro Val Trp Lys Leu Ala 145 150 155 160 Pro Ala Leu Ala Ala Gly Asn Thr Ala Val Ile Lys Pro Ala Thr Lys 165 170 175 Thr Pro Leu Met Val Ala Lys Leu Val Glu Val Leu Ser Lys Ala Gly 180 185 190 Leu Pro Glu Gly Val Val Asn Leu Val Val Gly Lys Gly Ser Glu Val 195 200 205 Gly Asp Thr Ile Val Ser Asp Asp Asn Ile Ala Ala Val Ser Phe Thr 210 215 220 Gly Ser Thr Glu Val Gly Lys Arg Ile Tyr Lys Leu Val Gly Asn Lys 225 230 235 240 Asn Arg Met Thr Arg Ile Gln Leu Glu Leu Gly Gly Lys Asn Ala Leu 245 250 255 Tyr Val Asp Lys Ser Ala Asp Leu Thr Leu Ala Ala Glu Leu Ala Val 260 265 270 Arg Gly Gly Phe Gly Leu Thr Gly Gln Ser Cys Thr Ala Thr Ser Arg 275 280 285 Leu Ile Ile Asn Lys Asp Val Tyr Thr Gln Phe Lys Gln Arg Leu Leu 290 295 300 Glu Arg Val Lys Lys Trp Arg Val Gly Pro Gly Thr Glu Asp Val Asp 305 310 315 320 Met Gly Pro Val Val Asp Glu Gly Gln Phe Lys Lys Asp Leu Glu Tyr 325 330 335 Ile Glu Tyr Gly Lys Asn Val Gly Ala Lys Leu Ile Tyr Gly Gly Asn 340 345 350 Ile Ile Pro Gly Lys Gly Tyr Phe Leu Glu Pro Thr Ile Phe Glu Gly 355 360 365 Val Thr Ser Asp Met Arg Leu Phe Lys Glu Glu Ile Phe Gly Pro Val 370 375 380 Leu Ser Val Thr Glu Ala Lys Asp Leu Asp Glu Ala Ile Arg Leu Val 385 390 395 400 Asn Ala Val Asp Tyr Gly His Thr Ala Gly Ile Val Ala Ser Asp Ile 405 410 415 Asn Ala Ile Asn Glu Phe Val Ser Arg Val Glu Ala Gly Val Ile Lys 420 425 430 Val Asn Lys Pro Thr Val Gly Leu Glu Leu Gln Ala Pro Phe Gly Gly 435 440 445 Phe Lys Asn Ser Gly Ala Thr Thr Trp Lys Glu Met Gly Glu Asp Ala 450 455 460 Leu Glu Phe Tyr Leu Lys Glu Lys Thr Val Tyr Glu Gly Trp 465 470 475 19478PRTSulfolobus islandicus 19Met Lys Ser Tyr Gln Gly Leu Ala Asp Lys Trp Ile Lys Gly Ser Gly 1 5 10 15 Glu Glu Tyr Leu Asp Ile Asn Pro Ala Asp Lys Asp His Val Leu Ala 20 25 30 Lys Ile Arg Leu Tyr Thr Lys Asp Asp Val Lys Glu Ala Ile Asn Lys 35 40 45 Ala Val Ala Lys Phe Asp Glu Trp Ser Arg Thr Pro Ala Pro Lys Arg 50 55 60 Gly Ser Ile Leu Leu Lys Ala Gly Glu Leu Met Glu Gln Glu Ala Gln 65 70 75 80 Glu Phe Ala Leu Leu Met Thr Leu Glu Glu Gly Lys Thr Leu Lys Asp 85 90 95 Ser Met Phe Glu Val Thr Arg Ser Tyr Asn Leu Leu Lys Phe Tyr Gly 100 105 110 Ala Leu Ala Phe Lys Ile Ser Gly Lys Thr Leu Pro Ser Ala Asp Pro 115 120 125 Asn Thr Arg Ile Phe Thr Val Lys Glu Pro Leu Gly Val Val Ala Leu 130 135 140 Ile Thr Pro Trp Asn Phe Pro Leu Ser Ile Pro Val Trp Lys Leu Ala 145 150 155 160 Pro Ala Leu Ala Ala Gly Asn Thr Ala Ile Ile Lys Pro Ala Thr Lys 165 170 175 Thr Pro Leu Met Val Ala Lys Leu Val Glu Val Leu Ser Lys Ala Gly 180 185 190 Leu Pro Glu Gly Val Val Asn Leu Val Val Gly Lys Gly Ser Glu Val 195 200 205 Gly Asp Thr Ile Val Ser Asp Asp Asn Ile Ala Ala Val Ser Phe Thr 210 215 220 Gly Ser Thr Glu Val Gly Lys Arg Ile Tyr Lys Leu Val Gly Asn Lys 225 230 235 240 Asn Arg Met Thr Arg Ile Gln Leu Glu Leu Gly Gly Lys Asn Ala Leu 245 250 255 Tyr Val Asp Lys Ser Ala Asp Leu Thr Leu Ala Ala Glu Leu Ala Val 260 265 270 Arg Gly Gly Phe Gly Leu Thr Gly Gln Ser Cys Thr Ala Thr Ser Arg

275 280 285 Leu Ile Ile Asn Lys Asp Val Tyr Thr Gln Phe Lys Gln Arg Leu Leu 290 295 300 Glu Arg Val Lys Lys Trp Arg Val Gly Pro Gly Thr Glu Asp Val Asp 305 310 315 320 Met Gly Pro Val Val Asp Glu Gly Gln Phe Lys Lys Asp Leu Glu Tyr 325 330 335 Ile Glu Tyr Gly Lys Asn Val Gly Ala Lys Leu Ile Tyr Gly Gly Asn 340 345 350 Ile Ile Pro Gly Lys Gly Tyr Phe Leu Glu Pro Thr Ile Phe Glu Gly 355 360 365 Val Thr Ser Asp Met Arg Leu Phe Lys Glu Glu Ile Phe Gly Pro Val 370 375 380 Leu Ser Val Thr Glu Ala Lys Asp Leu Asp Glu Ala Ile Arg Leu Val 385 390 395 400 Asn Ala Val Asp Tyr Gly His Thr Ala Gly Ile Val Ala Ser Asp Ile 405 410 415 Lys Ala Ile Asn Glu Phe Val Ser Arg Val Glu Ala Gly Val Ile Lys 420 425 430 Val Asn Lys Pro Thr Val Gly Leu Glu Leu Gln Ala Pro Phe Gly Gly 435 440 445 Phe Lys Asn Ser Gly Ala Thr Thr Trp Lys Glu Met Gly Glu Asp Ala 450 455 460 Leu Glu Phe Tyr Leu Lys Glu Lys Thr Val Tyr Glu Gly Trp 465 470 475 20478PRTSulfolobus islandicus 20Met Lys Ser Tyr Gln Gly Leu Ala Asp Lys Trp Ile Lys Gly Ser Gly 1 5 10 15 Glu Glu Tyr Leu Asp Ile Asn Pro Ala Asp Lys Asp His Val Leu Ala 20 25 30 Lys Ile Arg Leu Tyr Thr Lys Asp Asp Val Lys Glu Ala Ile Asn Lys 35 40 45 Ala Val Ala Lys Phe Asp Glu Trp Ser Arg Thr Pro Ala Pro Lys Arg 50 55 60 Gly Ser Ile Leu Leu Lys Ala Gly Glu Leu Met Glu Gln Glu Ala Gln 65 70 75 80 Glu Phe Ala Leu Leu Met Thr Leu Glu Glu Gly Lys Thr Leu Lys Asp 85 90 95 Ser Met Phe Glu Val Thr Arg Ser Tyr Asn Leu Leu Lys Phe Tyr Gly 100 105 110 Ala Leu Ala Phe Lys Ile Ser Gly Lys Thr Leu Pro Ser Ala Asp Pro 115 120 125 Asn Thr Arg Ile Phe Thr Val Lys Glu Pro Leu Gly Val Val Ala Leu 130 135 140 Ile Thr Pro Trp Asn Phe Pro Leu Ser Ile Pro Val Trp Lys Leu Ala 145 150 155 160 Pro Ala Leu Ala Ala Gly Asn Thr Ala Val Ile Lys Pro Ala Thr Lys 165 170 175 Thr Pro Leu Met Val Ala Lys Leu Val Glu Val Leu Ser Lys Ala Gly 180 185 190 Leu Pro Glu Gly Val Val Asn Leu Val Val Gly Lys Gly Ser Glu Val 195 200 205 Gly Asp Thr Ile Val Ser Asp Asp Asn Ile Ala Ala Val Ser Phe Thr 210 215 220 Gly Ser Thr Glu Val Gly Lys Arg Ile Tyr Lys Leu Val Gly Asn Lys 225 230 235 240 Asn Arg Met Thr Arg Ile Gln Leu Glu Leu Gly Gly Lys Asn Ala Leu 245 250 255 Tyr Val Asp Lys Ser Ala Asp Leu Thr Leu Ala Ala Glu Leu Ala Ile 260 265 270 Arg Gly Gly Phe Gly Leu Thr Gly Gln Ser Cys Thr Ala Thr Ser Arg 275 280 285 Leu Ile Ile Asn Lys Asp Val Tyr Thr Gln Phe Lys Gln Arg Leu Leu 290 295 300 Glu Arg Val Lys Lys Trp Arg Val Gly Pro Gly Thr Glu Asp Val Asp 305 310 315 320 Met Gly Pro Val Val Asp Glu Gly Gln Phe Lys Lys Asp Leu Glu Tyr 325 330 335 Ile Glu Tyr Gly Lys Asn Val Gly Ala Lys Leu Ile Tyr Gly Gly Asn 340 345 350 Ile Ile Pro Gly Lys Gly Tyr Phe Leu Glu Pro Thr Ile Phe Glu Gly 355 360 365 Val Thr Ser Asp Met Arg Leu Phe Lys Glu Glu Ile Phe Gly Pro Val 370 375 380 Leu Ser Val Thr Glu Ala Lys Asp Leu Asp Glu Ala Ile Arg Leu Val 385 390 395 400 Asn Ala Val Asp Tyr Gly His Thr Ala Gly Ile Val Ala Ser Asp Ile 405 410 415 Lys Ala Ile Asn Glu Phe Val Ser Arg Val Glu Ala Gly Val Ile Lys 420 425 430 Val Asn Lys Pro Thr Val Gly Leu Glu Leu Gln Ala Pro Phe Gly Gly 435 440 445 Phe Lys Asn Ser Gly Ala Thr Thr Trp Lys Glu Met Gly Glu Asp Ala 450 455 460 Leu Glu Phe Tyr Leu Lys Glu Lys Thr Val Tyr Glu Gly Trp 465 470 475 21488PRTBacillus subtilis 21Met Ser Val Ile Thr Glu Gln Asn Thr Tyr Leu Asn Phe Ile Asn Gly 1 5 10 15 Glu Trp Val Lys Ser Gln Ser Gly Asp Met Val Lys Val Glu Asn Pro 20 25 30 Ala Asp Val Asn Asp Ile Val Gly Tyr Val Gln Asn Ser Thr Ala Glu 35 40 45 Asp Val Glu Arg Ala Val Thr Ala Ala Asn Glu Ala Lys Thr Ala Trp 50 55 60 Arg Lys Leu Thr Gly Ala Glu Arg Gly Gln Tyr Leu Tyr Lys Thr Ala 65 70 75 80 Asp Ile Met Glu Gln Arg Leu Glu Glu Ile Ala Ala Cys Ala Thr Arg 85 90 95 Glu Met Gly Lys Thr Leu Pro Glu Ala Lys Gly Glu Thr Ala Arg Gly 100 105 110 Ile Ala Ile Leu Arg Tyr Tyr Ala Gly Glu Gly Met Arg Lys Thr Gly 115 120 125 Asp Val Ile Pro Ser Thr Asp Lys Asp Ala Leu Met Phe Thr Thr Arg 130 135 140 Val Pro Leu Gly Val Val Gly Val Ile Ser Pro Trp Asn Phe Pro Val 145 150 155 160 Ala Ile Pro Ile Trp Lys Met Ala Pro Ala Leu Val Tyr Gly Asn Thr 165 170 175 Val Val Ile Lys Pro Ala Thr Glu Thr Ala Val Thr Cys Ala Lys Ile 180 185 190 Ile Ala Cys Phe Glu Glu Ala Gly Leu Pro Ala Gly Val Ile Asn Leu 195 200 205 Val Thr Gly Pro Gly Ser Val Val Gly Gln Gly Leu Ala Glu His Asp 210 215 220 Gly Val Asn Ala Val Thr Phe Thr Gly Ser Asn Gln Val Gly Lys Ile 225 230 235 240 Ile Gly Gln Ala Ala Leu Ala Arg Gly Ala Lys Tyr Gln Leu Glu Met 245 250 255 Gly Gly Lys Asn Pro Val Ile Val Ala Asp Asp Ala Asp Leu Glu Ala 260 265 270 Ala Ala Glu Ala Val Ile Thr Gly Ala Phe Arg Ser Thr Gly Gln Lys 275 280 285 Cys Thr Ala Thr Ser Arg Val Ile Val Gln Ser Gly Ile Tyr Glu Arg 290 295 300 Phe Lys Glu Lys Leu Leu Gln Arg Thr Lys Asp Ile Thr Ile Gly Asp 305 310 315 320 Ser Leu Lys Glu Asp Val Trp Met Gly Pro Ile Ala Ser Lys Asn Gln 325 330 335 Leu Asp Asn Cys Leu Ser Tyr Ile Glu Lys Gly Lys Gln Glu Gly Ala 340 345 350 Ser Leu Leu Ile Gly Gly Glu Lys Leu Glu Asn Gly Lys Tyr Gln Asn 355 360 365 Gly Tyr Tyr Val Gln Pro Ala Ile Phe Asp Asn Val Thr Ser Glu Met 370 375 380 Thr Ile Ala Gln Glu Glu Ile Phe Gly Pro Val Ile Ala Leu Ile Lys 385 390 395 400 Val Asp Ser Ile Glu Glu Ala Leu Asn Ile Ala Asn Asp Val Lys Phe 405 410 415 Gly Leu Ser Ala Ser Ile Phe Thr Glu Asn Ile Gly Arg Met Leu Ser 420 425 430 Phe Ile Asp Glu Ile Asp Ala Gly Leu Val Arg Ile Asn Ala Glu Ser 435 440 445 Ala Gly Val Glu Leu Gln Ala Pro Phe Gly Gly Met Lys Gln Ser Ser 450 455 460 Ser His Ser Arg Glu Gln Gly Glu Ala Ala Lys Asp Phe Phe Thr Ala 465 470 475 480 Ile Lys Thr Val Phe Val Lys Pro 485 22488PRTBacillus subtilis 22Met Ser Val Ile Thr Glu Gln Asn Thr Tyr Leu Asn Phe Ile Asn Gly 1 5 10 15 Glu Trp Val Lys Ser Gln Ser Gly Asp Met Val Lys Val Glu Asn Pro 20 25 30 Ala Asp Val Asn Asp Ile Val Gly Tyr Val Gln Asn Ser Thr Ala Glu 35 40 45 Asp Val Glu Arg Ala Val Ala Ala Ala Asn Glu Ala Lys Thr Ala Trp 50 55 60 Arg Lys Leu Thr Gly Ala Glu Arg Gly Gln Tyr Leu Tyr Lys Thr Ala 65 70 75 80 Asp Ile Met Glu Gln Arg Leu Glu Glu Ile Ala Ala Cys Ala Thr Arg 85 90 95 Glu Met Gly Lys Thr Leu Pro Glu Ala Lys Gly Glu Thr Ala Arg Gly 100 105 110 Ile Ala Ile Leu Arg Tyr Tyr Ala Gly Glu Gly Met Arg Lys Thr Gly 115 120 125 Asp Val Ile Pro Ser Thr Asp Lys Asp Ala Leu Met Phe Thr Thr Arg 130 135 140 Val Pro Leu Gly Val Val Gly Val Ile Ser Pro Trp Asn Phe Pro Val 145 150 155 160 Ala Ile Pro Ile Trp Lys Met Ala Pro Ala Leu Val Tyr Gly Asn Thr 165 170 175 Val Val Ile Lys Pro Ala Thr Glu Thr Ala Val Thr Cys Ala Lys Ile 180 185 190 Ile Ala Cys Phe Glu Glu Ala Gly Leu Pro Ala Gly Val Ile Asn Leu 195 200 205 Val Thr Gly Pro Gly Ser Val Val Gly Gln Gly Leu Ala Glu His Glu 210 215 220 Gly Val Asn Ala Val Thr Phe Thr Gly Ser Asn Gln Val Gly Lys Ile 225 230 235 240 Ile Gly Gln Ala Ala Leu Ala Arg Gly Ala Lys Tyr Gln Leu Glu Met 245 250 255 Gly Gly Lys Asn Pro Val Ile Val Ala Asp Asp Ala Asp Leu Glu Ala 260 265 270 Ala Ala Glu Ala Val Ile Thr Gly Ala Phe Arg Ser Thr Gly Gln Lys 275 280 285 Cys Thr Ala Thr Ser Arg Ala Ile Val Gln Ser Gly Ile Tyr Glu Arg 290 295 300 Phe Lys Glu Lys Leu Leu Gln Arg Thr Lys Asp Ile Thr Ile Gly Asp 305 310 315 320 Ser Leu Lys Glu Asp Val Trp Met Gly Pro Ile Ala Ser Lys Asn Gln 325 330 335 Leu Asp Asn Cys Leu Ser Tyr Ile Glu Lys Gly Lys Gln Glu Gly Ala 340 345 350 Ser Leu Leu Ile Gly Gly Glu Lys Leu Glu Asn Gly Lys Tyr Gln Asn 355 360 365 Gly Tyr Tyr Val Gln Pro Ala Ile Phe Asp Asn Val Thr Ser Glu Met 370 375 380 Thr Ile Ala Gln Glu Glu Ile Phe Gly Pro Val Ile Ala Leu Ile Lys 385 390 395 400 Val Asp Ser Met Glu Glu Ala Leu Asn Ile Ala Asn Asp Val Lys Phe 405 410 415 Gly Leu Ser Ala Ser Ile Phe Thr Glu Asn Ile Gly Arg Met Leu Ser 420 425 430 Phe Ile Asp Glu Ile Asp Ala Gly Leu Val Arg Ile Asn Ala Glu Ser 435 440 445 Ala Gly Val Glu Leu Gln Ala Pro Phe Gly Gly Met Lys Gln Ser Ser 450 455 460 Ser His Ser Arg Glu Gln Gly Glu Ala Ala Lys Asp Phe Phe Thr Ala 465 470 475 480 Ile Lys Thr Val Phe Val Lys Pro 485 23488PRTBacillus subtilis 23Met Ser Val Ile Thr Glu Gln Asn Thr Tyr Leu Asn Phe Ile Lys Gly 1 5 10 15 Glu Trp Val Lys Ser Gln Ser Gly Asp Met Val Lys Val Glu Asn Pro 20 25 30 Ala Asp Val Asn Asp Ile Val Gly Tyr Val Gln Asn Ser Thr Ala Glu 35 40 45 Asp Val Glu Arg Ala Val Ala Ala Ala Asn Glu Ala Lys Thr Ala Trp 50 55 60 Arg Lys Leu Thr Gly Ala Glu Arg Gly Gln Tyr Leu Tyr Lys Thr Ala 65 70 75 80 Asp Ile Met Glu Gln Arg Leu Glu Glu Ile Ala Ala Cys Ala Thr Arg 85 90 95 Glu Met Gly Lys Thr Leu Pro Glu Ala Lys Gly Glu Thr Ala Arg Gly 100 105 110 Ile Ala Ile Leu Arg Tyr Tyr Ala Gly Glu Gly Met Arg Lys Thr Gly 115 120 125 Asp Val Ile Pro Ser Thr Asp Lys Ala Ala Leu Met Phe Thr Thr Arg 130 135 140 Val Pro Leu Gly Val Val Gly Val Ile Ser Pro Trp Asn Phe Pro Val 145 150 155 160 Ala Ile Pro Ile Trp Lys Met Ala Pro Ala Leu Val Tyr Gly Asn Thr 165 170 175 Val Val Ile Lys Pro Ala Thr Glu Thr Ala Val Thr Cys Ala Lys Ile 180 185 190 Ile Ala Cys Phe Glu Glu Ala Gly Leu Pro Ala Gly Val Ile Asn Leu 195 200 205 Val Thr Gly Pro Gly Ser Val Val Gly Gln Gly Leu Ala Glu His Asp 210 215 220 Gly Val Asn Ala Val Thr Phe Thr Gly Ser Asn Gln Val Gly Lys Ile 225 230 235 240 Ile Gly Gln Ala Ala Leu Ala Arg Gly Ala Lys Tyr Gln Leu Glu Met 245 250 255 Gly Gly Lys Asn Pro Val Ile Val Ala Asp Asp Ala Asp Leu Glu Ala 260 265 270 Ala Ala Glu Ala Val Ile Thr Gly Ala Phe Arg Ser Thr Gly Gln Lys 275 280 285 Cys Thr Ala Thr Ser Arg Val Ile Val Gln Ser Glu Ile Tyr Glu Arg 290 295 300 Phe Lys Glu Lys Leu Leu Gln Arg Thr Lys Asp Ile Thr Ile Gly Asp 305 310 315 320 Ser Leu Lys Glu Asp Val Trp Met Gly Pro Ile Ala Ser Lys Asn Gln 325 330 335 Leu Asp Asn Cys Leu Ser Tyr Ile Glu Lys Gly Lys Gln Glu Gly Ala 340 345 350 Ser Leu Leu Ile Gly Gly Glu Lys Leu Glu Asn Gly Lys Tyr Gln Asn 355 360 365 Gly Tyr Tyr Val Gln Pro Ala Ile Phe Asp Asn Val Thr Ser Glu Met 370 375 380 Thr Ile Ala Gln Glu Glu Ile Phe Gly Pro Val Ile Ala Leu Ile Lys 385 390 395 400 Val Asp Ser Met Glu Glu Ala Leu Asn Ile Ala Asn Asp Val Lys Phe 405 410 415 Gly Leu Ser Ala Ser Ile Phe Thr Glu Asn Ile Gly Arg Met Leu Ser 420 425 430 Phe Ile Asp Glu Ile Asp Ala Gly Leu Val Arg Ile Asn Ala Glu Ser 435 440 445 Ala Gly Val Glu Leu Gln Ala Pro Phe Gly Gly Met Lys Gln Ser Ser 450 455 460 Ser His Ser Arg Glu Gln Gly Glu Ala Ala Lys Asp Phe Phe Thr Ala 465 470 475 480 Ile Lys Thr Val Phe Val Lys Pro 485 24488PRTBacillus subtilis 24Met Ser Val Ile Thr Glu Gln Asn Thr Tyr Leu Asn Phe Ile Asn Gly 1 5 10 15 Glu Trp Val Lys Ser Gln Ser Gly Asp Met Val Lys Val Glu Asn Pro 20 25 30 Ala Asp Val Asn Asp Ile Val Gly Tyr Val Gln Asn Ser Thr Ala Asp 35 40 45 Asp Val Glu Arg Ala Val Ala Ala Ala Asn Glu Ala Lys Thr Ala Trp 50 55 60 Arg Lys Leu Thr Gly Ala Glu Arg Gly Gln Tyr Leu Tyr Lys Thr Ala 65 70 75 80 Asp Ile Met Glu Gln Arg Leu Glu Glu Ile Ala Ala Cys Ala Thr Arg 85 90 95 Glu Met Gly Lys Thr Leu Pro Glu Ala Lys Gly Glu Thr Ala Arg Gly 100 105 110 Ile Ala Ile Leu Arg Tyr Tyr Ala Gly Glu Gly Met Arg Lys Thr Gly 115 120 125 Asp Val Ile Pro Ser Thr Asp Lys Asp Ala Leu Met Phe Thr Thr Arg 130 135 140 Val Pro Leu Gly Val Val Gly Val Ile Ser Pro

Trp Asn Phe Pro Val 145 150 155 160 Ala Ile Pro Ile Trp Lys Met Ala Pro Ala Leu Val Tyr Gly Asn Thr 165 170 175 Val Val Ile Lys Pro Ala Thr Glu Thr Ala Val Thr Cys Ala Lys Ile 180 185 190 Ile Ala Cys Phe Glu Glu Ala Gly Leu Pro Ala Gly Val Ile Asn Leu 195 200 205 Val Thr Gly Pro Gly Ser Val Val Gly Gln Gly Leu Ala Glu His Glu 210 215 220 Gly Val Asn Ala Ile Thr Phe Thr Gly Ser Asn Gln Val Gly Lys Ile 225 230 235 240 Ile Gly Gln Ala Ala Leu Ala Arg Gly Ala Lys Tyr Gln Leu Glu Met 245 250 255 Gly Gly Lys Asn Pro Val Ile Val Ala Asp Asp Ala Asp Leu Glu Ala 260 265 270 Ala Ala Glu Ala Val Ile Thr Gly Ala Phe Arg Ser Thr Gly Gln Lys 275 280 285 Cys Thr Ala Thr Ser Arg Val Ile Val Gln Ser Gly Ile Tyr Asp Arg 290 295 300 Phe Lys Glu Lys Leu Leu Gln Arg Thr Lys Asp Ile Lys Ile Gly Asp 305 310 315 320 Ser Leu Lys Glu Asp Val Trp Met Gly Pro Ile Ala Ser Lys Asn Gln 325 330 335 Leu Asp Asn Cys Leu Ser Tyr Ile Glu Lys Gly Lys Gln Glu Gly Ala 340 345 350 Ser Leu Leu Ile Gly Gly Glu Lys Leu Glu Asp Gly Lys Tyr Gln Asn 355 360 365 Gly Tyr Tyr Val Gln Pro Ala Ile Phe Asp Asn Val Thr Ser Glu Met 370 375 380 Thr Ile Ala Gln Glu Glu Ile Phe Gly Pro Val Ile Ala Leu Ile Lys 385 390 395 400 Val Asp Ser Met Glu Glu Ala Leu Asp Ile Ala Asn Asp Val Lys Phe 405 410 415 Gly Leu Ser Ala Ser Ile Phe Thr Gln Asn Ile Gly Arg Met Leu Ser 420 425 430 Phe Val Asp Glu Ile Asp Ala Gly Leu Val Arg Ile Asn Ala Glu Ser 435 440 445 Ala Gly Val Glu Leu Gln Ala Pro Phe Gly Gly Met Lys Gln Ser Ser 450 455 460 Ser His Ser Arg Glu Gln Gly Glu Ala Ala Lys Asp Phe Phe Thr Ala 465 470 475 480 Ile Lys Thr Val Phe Val Lys Pro 485 25488PRTBacillus sp. JS 25Met Ser Val Ile Thr Glu Gln Asn Thr Tyr Leu Asn Phe Ile Asn Gly 1 5 10 15 Glu Trp Val Gln Ser Gln Ser Gly Asp Met Val Lys Val Glu Asn Pro 20 25 30 Ala Asp Val Asn Asp Ile Val Gly Tyr Val Gln Asn Ser Thr Ala Glu 35 40 45 Asp Val Glu Arg Ala Val Ala Ala Ala Asn Lys Ala Lys Thr Ala Trp 50 55 60 Arg Lys Leu Thr Gly Ala Glu Arg Gly Gln Tyr Leu Tyr Lys Thr Ala 65 70 75 80 Asp Ile Met Glu Arg Arg Leu Glu Glu Ile Ala Ala Cys Ala Thr Arg 85 90 95 Glu Met Gly Lys Thr Leu Pro Glu Ala Lys Gly Glu Thr Ala Arg Gly 100 105 110 Ile Ala Ile Leu Arg Tyr Tyr Ala Gly Glu Gly Met Arg Lys Thr Gly 115 120 125 Asp Val Ile Pro Ser Thr Asp Lys Asp Ala Leu Met Phe Thr Thr Arg 130 135 140 Val Pro Leu Gly Val Val Gly Val Ile Ser Pro Trp Asn Phe Pro Val 145 150 155 160 Ala Ile Pro Ile Trp Lys Met Ala Pro Ala Leu Val Tyr Gly Asn Thr 165 170 175 Val Val Ile Lys Pro Ala Thr Glu Thr Ala Val Thr Cys Ala Lys Ile 180 185 190 Ile Ala Cys Phe Glu Glu Ala Gly Leu Pro Ala Gly Val Ile Asn Leu 195 200 205 Val Thr Gly Pro Gly Ser Val Val Gly Gln Gly Leu Ala Glu His Asp 210 215 220 Ser Val Asn Ala Val Thr Phe Thr Gly Ser Asn Gln Val Gly Lys Ile 225 230 235 240 Ile Gly Gln Ala Ala Leu Ala Arg Gly Ala Lys Tyr Gln Leu Glu Met 245 250 255 Gly Gly Lys Asn Pro Val Ile Val Ala Asp Asp Ala Asp Leu Glu Ala 260 265 270 Ala Ala Glu Ala Val Ile Thr Gly Ala Phe Arg Ser Thr Gly Gln Lys 275 280 285 Cys Thr Ala Thr Ser Arg Val Ile Val Gln Ser Gly Ile Tyr Glu Arg 290 295 300 Phe Lys Glu Lys Leu Leu Gln Arg Thr Lys Asp Ile Thr Ile Gly Asp 305 310 315 320 Ser Leu Lys Glu Asp Val Trp Met Gly Pro Ile Ala Ser Lys Asn Gln 325 330 335 Leu Asp Asn Cys Leu Ser Tyr Ile Glu Lys Gly Lys Arg Glu Gly Ala 340 345 350 Ser Leu Leu Met Gly Gly Glu Lys Leu Glu Asn Glu Lys Tyr Gln Asn 355 360 365 Gly Tyr Tyr Val Gln Pro Ala Ile Phe Asp Asn Val Thr Ser Glu Met 370 375 380 Thr Ile Ala Gln Glu Glu Ile Phe Gly Pro Val Ile Ala Leu Ile Lys 385 390 395 400 Val Asp Ser Met Glu Glu Ala Leu Asp Ile Ala Asn Asp Val Lys Phe 405 410 415 Gly Leu Ser Ala Ser Ile Phe Thr Glu Asn Ile Gly Lys Met Leu Ser 420 425 430 Phe Ile Asp Glu Ile Asp Ala Gly Leu Val Arg Val Asn Ala Glu Ser 435 440 445 Ala Gly Val Glu Leu Gln Ala Pro Phe Gly Gly Met Lys Gln Ser Ser 450 455 460 Ser His Ser Arg Glu Gln Gly Glu Ala Ala Lys Asp Phe Phe Thr Ala 465 470 475 480 Ile Lys Thr Val Phe Val Lys Pro 485 26248PRTCaulobacter crescentus 26Met Ser Ser Ala Ile Tyr Pro Ser Leu Lys Gly Lys Arg Val Val Ile 1 5 10 15 Thr Gly Gly Gly Ser Gly Ile Gly Ala Gly Leu Thr Ala Gly Phe Ala 20 25 30 Arg Gln Gly Ala Glu Val Ile Phe Leu Asp Ile Ala Asp Glu Asp Ser 35 40 45 Arg Ala Leu Glu Ala Glu Leu Ala Gly Ser Pro Ile Pro Pro Val Tyr 50 55 60 Lys Arg Cys Asp Leu Met Asn Leu Glu Ala Ile Lys Ala Val Phe Ala 65 70 75 80 Glu Ile Gly Asp Val Asp Val Leu Val Asn Asn Ala Gly Asn Asp Asp 85 90 95 Arg His Lys Leu Ala Asp Val Thr Gly Ala Tyr Trp Asp Glu Arg Ile 100 105 110 Asn Val Asn Leu Arg His Met Leu Phe Cys Thr Gln Ala Val Ala Pro 115 120 125 Gly Met Lys Lys Arg Gly Gly Gly Ala Val Ile Asn Phe Gly Ser Ile 130 135 140 Ser Trp His Leu Gly Leu Glu Asp Leu Val Leu Tyr Glu Thr Ala Lys 145 150 155 160 Ala Gly Ile Glu Gly Met Thr Arg Ala Leu Ala Arg Glu Leu Gly Pro 165 170 175 Asp Asp Ile Arg Val Thr Cys Val Val Pro Gly Asn Val Lys Thr Lys 180 185 190 Arg Gln Glu Lys Trp Tyr Thr Pro Glu Gly Glu Ala Gln Ile Val Ala 195 200 205 Ala Gln Cys Leu Lys Gly Arg Ile Val Pro Glu Asn Val Ala Ala Leu 210 215 220 Val Leu Phe Leu Ala Ser Asp Asp Ala Ser Leu Cys Thr Gly His Glu 225 230 235 240 Tyr Trp Ile Asp Ala Gly Trp Arg 245 27250PRTPhenylobacterium zucineum 27Met Gly Val Thr Ser Ala Ile Tyr Pro Ser Leu Lys Gly Lys Arg Val 1 5 10 15 Val Val Thr Gly Gly Gly Ser Gly Ile Gly Ala Gly Leu Val Glu Ala 20 25 30 Phe Val Arg Gln Gly Ala Glu Val His Phe Leu Asp Val Leu Glu Thr 35 40 45 Glu Ser Arg Val Leu Glu Thr Ser Leu Ala Gly Ala Glu Val Pro Pro 50 55 60 Val Phe His Arg Cys Asp Leu Thr Asp Ala Gly Ala Ile Glu Gly Cys 65 70 75 80 Phe Ala Lys Ile Gly Pro Val Gln Val Leu Val Asn Asn Ala Gly Asn 85 90 95 Asp Asp Arg His Thr Leu Asp Glu Val Thr Pro Ala Tyr Phe Asp Asp 100 105 110 Arg Ile Ala Val Asn Leu Arg His Met Val Phe Cys Ala Lys Ala Val 115 120 125 Val Pro Ala Met Lys Ala Ala Gly Glu Gly Ala Ile Ile Asn Phe Gly 130 135 140 Ser Ile Ser Trp His Leu Gly Leu Pro Asp Leu Val Leu Tyr Glu Thr 145 150 155 160 Ala Lys Ala Gly Ile Glu Gly Met Thr Arg Ala Leu Ala Arg Glu Leu 165 170 175 Gly Pro Phe Gly Ile Arg Val Thr Cys Val Ala Pro Gly Asn Val Lys 180 185 190 Thr Leu Arg Gln Met Lys Trp Tyr Thr Pro Glu Gly Glu Ala Glu Ile 195 200 205 Val Ala Gln Gln Cys Leu Lys Ser Arg Ile Glu Pro Ala Asp Val Ala 210 215 220 Ala Leu Val Leu Phe Leu Ala Ser Asp Asp Ala Arg Met Cys Thr Gly 225 230 235 240 His Glu Tyr Trp Ile Asp Ala Gly Trp Arg 245 250 28248PRTCaulobacter sp. AP07 28Met Ser Ser Ala Ile Tyr Pro Ser Leu Gln Gly Lys Arg Val Val Val 1 5 10 15 Thr Gly Gly Gly Ser Gly Ile Gly Ala Gly Ile Val Ala Ala Phe Ala 20 25 30 Arg Gln Gly Ala Glu Val Ile Phe Leu Asp Val Val Asp Ala Asp Ser 35 40 45 Glu Ala Leu Ala Ala Lys Leu Ser Asp Ser Pro Ile Ala Pro Thr Tyr 50 55 60 Met Arg Cys Asp Leu Thr Asp Leu Glu Ala Met Ala Glu Thr Phe Ala 65 70 75 80 Arg Ile Gly Pro Ile Asp Val Leu Val Asn Asn Ala Gly Asn Asp Asp 85 90 95 Arg His Gly Leu Ala Glu Ile Thr Pro Ala Tyr Trp Asp Gln Arg Met 100 105 110 Ala Val Asn Leu Arg His Met Leu Phe Ala Thr Gln Ala Val Ala Pro 115 120 125 Gly Met Lys Ala Arg Gly Gly Gly Ala Val Ile Asn Phe Gly Ser Ile 130 135 140 Ser Trp His Leu Gly Leu Pro Asp Leu Val Leu Tyr Glu Thr Ala Lys 145 150 155 160 Ala Gly Ile Glu Gly Met Thr Arg Ala Leu Ala Arg Glu Leu Gly Pro 165 170 175 Asp Asp Ile Arg Val Thr Cys Val Val Pro Gly Asn Val Lys Thr Lys 180 185 190 Arg Gln Glu Lys Trp Tyr Thr Pro Glu Gly Glu Ala Glu Ile Val Ala 195 200 205 Ala Gln Ala Leu Lys Gly Arg Leu Val Pro Asp His Val Ala Ser Leu 210 215 220 Val Leu Phe Leu Ala Ser Asp Asp Ala Ala Leu Cys Thr Gly His Glu 225 230 235 240 Tyr Trp Ile Asp Ala Gly Trp Arg 245 29259PRTCaulobacter sp. K31 29Met Asn Ile Glu Val Lys Arg Pro Gln Val Ser Thr Ser Ser Ala Ile 1 5 10 15 Tyr Pro Ser Leu Lys Gly Lys Arg Val Val Val Thr Gly Gly Gly Ser 20 25 30 Gly Ile Gly Ala Gly Ile Val Ala Gly Phe Ala Arg Gln Gly Ser Glu 35 40 45 Val Ile Phe Leu Asp Val Ala Asp Gln Asp Ser Lys Ala Leu Ala Glu 50 55 60 Gln Leu Ser Gly Ala Glu Ile Ala Pro Val Tyr Leu Arg Cys Asp Leu 65 70 75 80 Thr Asp Leu Asp Ala Val Ala Lys Thr Phe Ala Asp Ile Gly Pro Val 85 90 95 Asp Val Leu Val Asn Asn Ala Gly Asn Asp Asp Arg His Gly Leu Ala 100 105 110 Gln Ile Thr Pro Ala Tyr Trp Asp Glu Arg Met Ser Val Asn Leu Arg 115 120 125 His Met Leu Phe Ala Thr Gln Ala Val Ala Pro Gly Met Lys Ala Arg 130 135 140 Gly Gly Gly Ala Ile Ile Asn Phe Gly Ser Ile Ser Trp His Leu Gly 145 150 155 160 Leu Pro Asp Leu Val Leu Tyr Glu Thr Ala Lys Ala Gly Ile Glu Gly 165 170 175 Met Thr Arg Ala Leu Ala Arg Glu Leu Gly Pro Asp Asp Ile Arg Val 180 185 190 Thr Cys Val Val Pro Gly Asn Ile Lys Thr Lys Arg Gln Glu Lys Trp 195 200 205 Tyr Thr Pro Glu Gly Glu Ala Glu Ile Val Ala Ala Gln Ala Leu Lys 210 215 220 Gly Arg Leu Val Pro Asp His Val Ala Ser Leu Val Met Phe Leu Ala 225 230 235 240 Ser Asp Asp Ala Ser Leu Cys Thr Gly His Glu Tyr Trp Ile Asp Ala 245 250 255 Gly Trp Arg 30249PRTCaulobacter segnis 30Met Ser Ser Ala Ile Tyr Pro Ser Leu Lys Gly Lys Arg Val Val Ile 1 5 10 15 Thr Gly Gly Gly Ser Gly Ile Gly Ala Gly Leu Val Ala Gly Phe Val 20 25 30 Arg Gln Gly Ala Glu Val Ile Phe Leu Asp Ile Val Asp Ala Asp Ser 35 40 45 Gln Ala Leu Val Ala Glu Leu Ser Lys Asp Ala Val Ile Ala Pro Val 50 55 60 Tyr Lys Arg Cys Asp Leu Met Asp Ile Asp Ala Leu Lys Ala Thr Phe 65 70 75 80 Ala Glu Ile Gly Asp Val Asp Val Leu Val Asn Asn Ala Gly Asn Asp 85 90 95 Asp Arg His Ser Leu Ala Asp Leu Thr Pro Ala Tyr Trp Asp Asn Arg 100 105 110 Ile Gly Val Asn Leu Arg His Met Val Phe Ala Ala Gln Ala Val Ala 115 120 125 Gly Gly Met Lys Lys Arg Gly Gly Gly Ala Ile Ile Asn Phe Gly Ser 130 135 140 Ile Ser Trp His Leu Gly Leu Glu Asp Leu Val Leu Tyr Glu Thr Ala 145 150 155 160 Lys Ala Gly Ile Glu Gly Met Thr Arg Ala Leu Ala Arg Glu Leu Gly 165 170 175 Pro Asp Asp Ile Arg Val Thr Cys Val Val Pro Gly Asn Val Lys Thr 180 185 190 Lys Arg Gln Glu Lys Trp Tyr Thr Pro Glu Gly Glu Ala Glu Ile Val 195 200 205 Lys Ala Gln Cys Leu Lys Gly Arg Ile Leu Pro Asp His Val Ala Ser 210 215 220 Leu Val Leu Phe Leu Ala Ser Asp Asp Ala Ser Leu Cys Thr Gly His 225 230 235 240 Glu Tyr Trp Ile Asp Ala Gly Trp Arg 245 31289PRTCaulobacter crescentus 31Met Thr Ala Gln Val Thr Cys Val Trp Asp Leu Lys Ala Thr Leu Gly 1 5 10 15 Glu Gly Pro Ile Trp His Gly Asp Thr Leu Trp Phe Val Asp Ile Lys 20 25 30 Gln Arg Lys Ile His Asn Tyr His Pro Ala Thr Gly Glu Arg Phe Ser 35 40 45 Phe Asp Ala Pro Asp Gln Val Thr Phe Leu Ala Pro Ile Val Gly Ala 50 55 60 Thr Gly Phe Val Val Gly Leu Lys Thr Gly Ile His Arg Phe His Pro 65 70 75 80 Ala Thr Gly Phe Ser Leu Leu Leu Glu Val Glu Asp Ala Ala Leu Asn 85 90 95 Asn Arg Pro Asn Asp Ala Thr Val Asp Ala Gln Gly Arg Leu Trp Phe 100 105 110 Gly Thr Met His Asp Gly Glu Glu Asn Asn Ser Gly Ser Leu Tyr Arg 115 120 125 Met Asp Leu Thr Gly Val Ala Arg Met Asp Arg Asp Ile Cys Ile Thr 130 135 140 Asn Gly Pro Cys Val Ser Pro Asp Gly Lys Thr Phe Tyr His Thr Asp 145 150 155 160 Thr Leu Glu Lys Thr Ile Tyr Ala Phe Asp Leu Ala Glu Asp Gly Leu 165 170 175 Leu Ser Asn Lys Arg Val Phe Val Gln Phe Ala Leu Gly Asp Asp Val 180 185 190 Tyr Pro Asp Gly Ser Val Val

Asp Ser Glu Gly Tyr Leu Trp Thr Ala 195 200 205 Leu Trp Gly Gly Phe Gly Ala Val Arg Phe Ser Pro Gln Gly Asp Ala 210 215 220 Val Thr Arg Ile Glu Leu Pro Ala Pro Asn Val Thr Lys Pro Cys Phe 225 230 235 240 Gly Gly Pro Asp Leu Lys Thr Leu Tyr Phe Thr Thr Ala Arg Lys Gly 245 250 255 Leu Ser Asp Glu Thr Leu Ala Gln Tyr Pro Leu Ala Gly Gly Val Phe 260 265 270 Ala Val Pro Val Asp Val Ala Gly Gln Pro Gln His Glu Val Arg Leu 275 280 285 Val 32289PRTCaulobacter segnis 32Met Thr Ala Glu Val Thr Cys Val Trp Asp Leu Lys Ala Thr Leu Gly 1 5 10 15 Glu Gly Pro Ile Trp His Gly Asp Ala Leu Trp Phe Val Asp Ile Lys 20 25 30 Gln Arg Lys Ile His Asn Tyr Lys Pro Thr Thr Gly Glu His Phe Ser 35 40 45 Phe Asp Ala Pro Asp Gln Val Thr Phe Leu Ala Pro Ile Ala Asp Ala 50 55 60 Gly Gly Phe Val Val Gly Leu Lys Thr Gly Ile His Arg Phe His Pro 65 70 75 80 Ile Thr Gly Phe Arg Leu Leu Ile Glu Val Glu Asp Ser Ala Leu Asp 85 90 95 Asn Arg Pro Asn Asp Ala Thr Val Asp Ala Asn Gly Arg Leu Trp Phe 100 105 110 Gly Thr Met His Asp Gly Glu Glu Ala Lys Ser Gly Ser Leu Tyr Arg 115 120 125 Met Asp Ala Glu Gly Val Ala Arg Met Asp Lys Asp Ile Cys Ile Thr 130 135 140 Asn Gly Pro Cys Val Ser Pro Asp Gly Lys Thr Phe Tyr His Thr Asp 145 150 155 160 Thr Leu Glu Lys Thr Val Trp Ala Tyr Asp Leu Ala Glu Asp Gly Thr 165 170 175 Leu Ser Asn Lys Arg Ala Phe Val His Val Lys Leu Gly Asp Asp Ile 180 185 190 Tyr Pro Asp Gly Thr Val Val Asp Ser Glu Gly Cys Leu Trp Ile Ala 195 200 205 Leu Trp Gly Gly Phe Gly Val Ile Arg Val Ser Pro Ala Gly Glu Ile 210 215 220 Val Gly Arg Ile Glu Val Pro Ala Pro Asn Val Thr Lys Val Cys Phe 225 230 235 240 Gly Gly Pro Asp Leu Lys Thr Leu Phe Leu Thr Thr Ala Arg Lys Gly 245 250 255 Leu Ser Asp Glu Thr Leu Ala Gln Tyr Pro Leu Ala Gly Gly Leu Phe 260 265 270 Ala Ile Gly Val Asn Ile Ala Gly Gln Pro Gln His Glu Val Arg Leu 275 280 285 Val 33291PRTCaulobacter sp. AP07 33Met Pro Glu Pro Ile Cys Val Trp Asp Leu Lys Ala Thr Leu Gly Glu 1 5 10 15 Gly Pro Ile Trp Ile Ala Ala Glu Gln Ala Leu Trp Phe Val Asp Ile 20 25 30 Lys Ser His Lys Val His Arg Phe His Pro Glu Ser Gly Glu Thr Lys 35 40 45 Ser Phe Asp Ala Pro Asp Gln Val Thr Phe Leu Ala Pro Arg Ala Gly 50 55 60 Gly Gly Phe Val Ala Gly Leu Lys Ser Gly Leu His His Phe His Pro 65 70 75 80 Glu Thr Gly Phe Ala Tyr Leu Gly Glu Ile Glu Pro Ala Asp Leu Asn 85 90 95 Asn Arg Pro Asn Asp Ala Thr Val Asp Ala Glu Gly Arg Leu Trp Phe 100 105 110 Gly Thr Met His Asp Gly Glu Glu Thr Pro Thr Gly Ala Leu Tyr Arg 115 120 125 Leu Gly Ala Asp Gly Gln Pro Val Gln Gln Asp Gln Gly Val Cys Ile 130 135 140 Thr Asn Gly Pro Cys Val Ser Pro Asp Gly Lys Thr Phe Tyr His Thr 145 150 155 160 Asp Thr Leu Glu Lys Val Ile Trp Ala Tyr Asp Leu Gly Ala Asp Gly 165 170 175 Glu Leu Ser Asn Lys Arg Gln Phe Phe Arg Leu Glu Ile Asp Asp Ala 180 185 190 Trp Pro Asp Gly Ser Val Val Asp Ala Glu Gly Tyr Val Trp Ala Ala 195 200 205 Leu Trp Gly Gly His Gly Ala Ile Arg Ile Ser Pro Ala Gly Glu Leu 210 215 220 Val Asp Arg Val Thr Leu Pro Ala Ile Asn Val Thr Lys Pro Cys Phe 225 230 235 240 Gly Gly Pro Asp Leu Lys Thr Leu Tyr Phe Thr Thr Ala Arg Lys Gly 245 250 255 Leu Gly Asp Glu Gln Leu Ala Ala Tyr Pro Leu Cys Gly Gly Val Phe 260 265 270 Ala Leu Pro Val Ala Val Ala Gly Gln Pro Gln Tyr Glu Val Arg Leu 275 280 285 Asp Leu Pro 290 34293PRTCaulobacter sp. K31 34Met Pro Glu Pro Ile Cys Val Trp Asp Leu Lys Ala Thr Leu Gly Glu 1 5 10 15 Gly Pro Ile Trp Ser Ala Glu Glu Gln Ala Val Trp Phe Val Asp Ile 20 25 30 Lys Gly His Lys Val His Arg Phe His Pro Ala Ser Gly Ala Thr Ala 35 40 45 Ser Phe Asp Ala Pro Asp Gln Val Thr Phe Leu Ala Pro His Ala Gly 50 55 60 Gly Gly Gly Phe Val Ala Gly Leu Lys Ser Gly Leu His Arg Phe Asp 65 70 75 80 Pro Thr Thr Gly Ala Phe Val Phe Leu Ala Gln Ile Glu Pro Pro Glu 85 90 95 Leu Asn Asn Arg Pro Asn Asp Ala Thr Val Asp Ala Glu Gly Arg Leu 100 105 110 Trp Phe Gly Thr Met His Asp Gly Glu Met Thr Pro Thr Gly Ala Leu 115 120 125 Tyr Arg Leu Ser Ala Asp Gly Lys Pro Ile Gln Gln Asp Glu Gly Val 130 135 140 Cys Ile Thr Asn Gly Pro Cys Ala Ser Pro Asp Gly Lys Thr Phe Tyr 145 150 155 160 His Thr Asp Thr Leu Glu Lys Val Ile Trp Ala Tyr Asp Leu Gly Ala 165 170 175 Asp Gly Ser Leu Ser Asn Lys Arg Glu Phe Phe Arg Leu Glu Ile Ala 180 185 190 Asp Ala Trp Pro Asp Gly Ser Val Val Asp Ser Glu Gly Phe Val Trp 195 200 205 Thr Ala Leu Trp Gly Gly His Gly Ala Leu Arg Leu Ser Pro Ala Gly 210 215 220 Glu Ile Val Asp Arg Val Ile Leu Pro Ala Ile Asn Val Thr Lys Pro 225 230 235 240 Cys Phe Gly Gly Pro Asp Leu Lys Thr Val Tyr Phe Thr Ser Ala Arg 245 250 255 Lys Gly Leu Ser Asp Glu Gln Leu Ala Ala Tyr Pro Gln Cys Gly Gly 260 265 270 Leu Phe Ala Leu Pro Val Ala Val Ala Gly Gln Pro Gln Tyr Glu Val 275 280 285 Arg Leu Asp Leu Arg 290 35292PRTPhenylobacterium zucineum 35Met Lys Val Leu Ser Glu Pro Asp Cys Val Leu Arg Ala Asp Ala Glu 1 5 10 15 Leu Gly Glu Gly Pro Val Trp Arg Ala Asp Asp Asp Ala Val Trp Phe 20 25 30 Val Asp Ile Lys Gly Arg Arg Ile His Arg Tyr Glu Pro Val Thr Gly 35 40 45 Ala Ala Trp Ser Trp Ala Ala Pro Ala Gln Pro Gly Phe Ile Ala Pro 50 55 60 Val Ala Gly Gly Gly Trp Val Ala Gly Leu Lys Thr Gly Leu His Arg 65 70 75 80 Phe Glu Pro Arg Gly Gly Arg Phe Glu Leu Ile Thr Ala Val Glu Asp 85 90 95 Pro Ser Leu Asp Asn Arg Leu Asn Asp Gly Phe Val Asp Ala Lys Gly 100 105 110 Arg Leu Trp Phe Gly Ser Met His Asp Gly Glu Thr Ala Leu Thr Gly 115 120 125 Ala Leu Tyr Arg Leu Asp Glu Arg Gly Leu Gln Arg Cys Asp Thr Gly 130 135 140 Tyr Cys Ile Thr Asn Gly Pro Ala Ala Ser Pro Asp Gly Arg Thr Leu 145 150 155 160 Tyr His Thr Asp Thr Leu Gln Lys Thr Ile Tyr Ala Phe Asp Leu Ser 165 170 175 Pro Ala Gly Glu Leu Ser Asn Lys Arg Val Phe Ala Arg Ile Glu Glu 180 185 190 Gly Gly Gly Tyr Pro Asp Gly Pro Ala Val Asp Ala Glu Gly Cys Val 195 200 205 Trp Thr Gly Leu Phe Ala Gly Trp His Val Arg Arg Tyr Ser Pro Lys 210 215 220 Gly Glu Leu Leu Ala Lys Val Gly Phe Pro Val Ala Asn Ile Thr Lys 225 230 235 240 Leu Ala Phe Gly Gly Asp Asp Leu Thr Ser Val Tyr Ala Thr Thr Ala 245 250 255 Trp Lys Gly Leu Ser Ala Asp Glu Arg Glu Lys Gln Pro Leu Ala Gly 260 265 270 Gly Leu Phe Arg Phe Glu Val Asp Val Pro Gly Leu Pro Gln Asn Gln 275 280 285 Met Ala His Ala 290 36595PRTCaulobacter crescentus 36Met Arg Ser Ala Leu Ser Asn Arg Thr Pro Arg Arg Phe Arg Ser Arg 1 5 10 15 Asp Trp Phe Asp Asn Pro Asp His Ile Asp Met Thr Ala Leu Tyr Leu 20 25 30 Glu Arg Phe Met Asn Tyr Gly Ile Thr Pro Glu Glu Leu Arg Ser Gly 35 40 45 Lys Pro Ile Ile Gly Ile Ala Gln Thr Gly Ser Asp Ile Ser Pro Cys 50 55 60 Asn Arg Ile His Leu Asp Leu Val Gln Arg Val Arg Asp Gly Ile Arg 65 70 75 80 Asp Ala Gly Gly Ile Pro Met Glu Phe Pro Val His Pro Ile Phe Glu 85 90 95 Asn Cys Arg Arg Pro Thr Ala Ala Leu Asp Arg Asn Leu Ser Tyr Leu 100 105 110 Gly Leu Val Glu Thr Leu His Gly Tyr Pro Ile Asp Ala Val Val Leu 115 120 125 Thr Thr Gly Cys Asp Lys Thr Thr Pro Ala Gly Ile Met Ala Ala Thr 130 135 140 Thr Val Asn Ile Pro Ala Ile Val Leu Ser Gly Gly Pro Met Leu Asp 145 150 155 160 Gly Trp His Glu Asn Glu Leu Val Gly Ser Gly Thr Val Ile Trp Arg 165 170 175 Ser Arg Arg Lys Leu Ala Ala Gly Glu Ile Thr Glu Glu Glu Phe Ile 180 185 190 Asp Arg Ala Ala Ser Ser Ala Pro Ser Ala Gly His Cys Asn Thr Met 195 200 205 Gly Thr Ala Ser Thr Met Asn Ala Val Ala Glu Ala Leu Gly Leu Ser 210 215 220 Leu Thr Gly Cys Ala Ala Ile Pro Ala Pro Tyr Arg Glu Arg Gly Gln 225 230 235 240 Met Ala Tyr Lys Thr Gly Gln Arg Ile Val Asp Leu Ala Tyr Asp Asp 245 250 255 Val Lys Pro Leu Asp Ile Leu Thr Lys Gln Ala Phe Glu Asn Ala Ile 260 265 270 Ala Leu Val Ala Ala Ala Gly Gly Ser Thr Asn Ala Gln Pro His Ile 275 280 285 Val Ala Met Ala Arg His Ala Gly Val Glu Ile Thr Ala Asp Asp Trp 290 295 300 Arg Ala Ala Tyr Asp Ile Pro Leu Ile Val Asn Met Gln Pro Ala Gly 305 310 315 320 Lys Tyr Leu Gly Glu Arg Phe His Arg Ala Gly Gly Ala Pro Ala Val 325 330 335 Leu Trp Glu Leu Leu Gln Gln Gly Arg Leu His Gly Asp Val Leu Thr 340 345 350 Val Thr Gly Lys Thr Met Ser Glu Asn Leu Gln Gly Arg Glu Thr Ser 355 360 365 Asp Arg Glu Val Ile Phe Pro Tyr His Glu Pro Leu Ala Glu Lys Ala 370 375 380 Gly Phe Leu Val Leu Lys Gly Asn Leu Phe Asp Phe Ala Ile Met Lys 385 390 395 400 Ser Ser Val Ile Gly Glu Glu Phe Arg Lys Arg Tyr Leu Ser Gln Pro 405 410 415 Gly Gln Glu Gly Val Phe Glu Ala Arg Ala Ile Val Phe Asp Gly Ser 420 425 430 Asp Asp Tyr His Lys Arg Ile Asn Asp Pro Ala Leu Glu Ile Asp Glu 435 440 445 Arg Cys Ile Leu Val Ile Arg Gly Ala Gly Pro Ile Gly Trp Pro Gly 450 455 460 Ser Ala Glu Val Val Asn Met Gln Pro Pro Asp His Leu Leu Lys Lys 465 470 475 480 Gly Ile Met Ser Leu Pro Thr Leu Gly Asp Gly Arg Gln Ser Gly Thr 485 490 495 Ala Asp Ser Pro Ser Ile Leu Asn Ala Ser Pro Glu Ser Ala Ile Gly 500 505 510 Gly Gly Leu Ser Trp Leu Arg Thr Gly Asp Thr Ile Arg Ile Asp Leu 515 520 525 Asn Thr Gly Arg Cys Asp Ala Leu Val Asp Glu Ala Thr Ile Ala Ala 530 535 540 Arg Lys Gln Asp Gly Ile Pro Ala Val Pro Ala Thr Met Thr Pro Trp 545 550 555 560 Gln Glu Ile Tyr Arg Ala His Ala Ser Gln Leu Asp Thr Gly Gly Val 565 570 575 Leu Glu Phe Ala Val Lys Tyr Gln Asp Leu Ala Ala Lys Leu Pro Arg 580 585 590 His Asn His 595 37597PRTCaulobacter sp. K31 37Met Thr Ser Ala Asn Thr Pro Ser Gly Arg Pro Pro Arg Arg Phe Arg 1 5 10 15 Ser Arg Asp Trp Phe Asp Asn Pro Asp His Ile Asp Met Thr Ala Leu 20 25 30 Tyr Leu Glu Arg Phe Met Asn Tyr Gly Ile Thr Pro Glu Glu Leu Arg 35 40 45 Ser Gly Lys Pro Ile Ile Gly Ile Ala Gln Thr Gly Ser Asp Ile Ser 50 55 60 Pro Cys Asn Arg Ile His Leu Asp Leu Val Thr Arg Ile Arg Asp Gly 65 70 75 80 Ile Arg Asp Ala Gly Gly Ile Pro Met Glu Phe Pro Val His Pro Ile 85 90 95 Phe Glu Asn Cys Arg Arg Pro Thr Ala Ala Leu Asp Arg Asn Leu Ser 100 105 110 Tyr Leu Gly Leu Val Glu Val Leu His Gly Tyr Pro Ile Asp Ala Val 115 120 125 Val Leu Thr Thr Gly Cys Asp Lys Thr Thr Pro Ala Gly Ile Met Ala 130 135 140 Ala Thr Thr Val Asn Ile Pro Ala Ile Val Leu Ser Gly Gly Pro Met 145 150 155 160 Leu Asp Gly Trp His Asp Gly Glu Leu Val Gly Ser Gly Thr Val Ile 165 170 175 Trp Arg Ser Arg Arg Lys Leu Ala Ala Gly Glu Ile Asn Glu Glu Glu 180 185 190 Phe Ile Gln Arg Ala Ser Asp Ser Ala Pro Ser Ala Gly His Cys Asn 195 200 205 Thr Met Gly Thr Ala Ser Thr Met Asn Ala Val Ala Glu Ala Leu Gly 210 215 220 Leu Ser Leu Thr Gly Cys Ala Ala Ile Pro Ala Pro Tyr Arg Glu Arg 225 230 235 240 Gly Gln Met Ala Tyr Lys Thr Gly Gln Arg Ile Val Asp Leu Ala Tyr 245 250 255 Glu Asp Val Lys Pro Leu Asp Ile Leu Thr Lys Lys Ala Phe Glu Asn 260 265 270 Ala Ile Ala Leu Val Ala Ala Ala Gly Gly Ser Thr Asn Ala Gln Pro 275 280 285 His Ile Val Ala Met Ala Arg His Ala Gly Leu Asp Ile Thr Ala Asp 290 295 300 Asp Trp Arg Ala Ala Tyr Asp Ile Pro Leu Ile Leu Asn Met Gln Pro 305 310 315 320 Ala Gly Lys Tyr Leu Gly Glu Arg Phe His Arg Ala Gly Gly Ala Pro 325 330 335 Ala Val Leu Trp Glu Leu Leu Gln Ala Gly Arg Leu His Gly Asp Val 340 345 350 Met Thr Val Thr Gly Lys Thr Met Gly Glu Asn Leu Glu Gly Arg Glu 355 360 365 Thr Lys Asp Arg Glu Val Val Phe Pro Tyr Gly Gln Pro Met Ser Glu 370 375 380 Arg Ala Gly Phe Leu Val Leu Lys Gly Asn Leu Phe Asp Phe Ala Ile 385 390 395 400 Met Lys Thr Ser Val Ile Ser Gln Glu Phe Arg Gln Arg Tyr Leu Ser 405 410 415 Glu Pro Gly Lys Glu Asp Ser Phe Glu Ala Arg Ala Val Val Phe Asp 420 425

430 Gly Ser Asp Asp Tyr His Ala Arg Ile Asn Asp Pro Ser Leu Asn Ile 435 440 445 Asp Glu Arg Thr Ile Leu Val Ile Arg Gly Ala Gly Pro Ile Gly Trp 450 455 460 Pro Gly Ser Ala Glu Val Val Asn Met Gln Pro Pro Asp Ala Leu Leu 465 470 475 480 Lys Arg Gly Ile Met Ser Leu Pro Thr Leu Gly Asp Gly Arg Gln Ser 485 490 495 Gly Thr Ala Asp Ser Pro Ser Ile Leu Asn Ala Ser Pro Glu Ser Ala 500 505 510 Ile Gly Gly Gly Leu Ser Trp Leu Arg Thr Gly Asp Met Ile Arg Ile 515 520 525 Asp Leu Asn Thr Gly Arg Cys Asp Ala Leu Val Asp Glu Ala Thr Ile 530 535 540 Ala Glu Arg Arg Lys Glu Gly Val Pro Pro Val Pro Ala Thr Met Thr 545 550 555 560 Pro Trp Gln Glu Ile Tyr Arg Ala His Thr Gly Gln Leu Glu Thr Gly 565 570 575 Gly Val Leu Glu Phe Ala Val Lys Tyr Gln Asp Leu Ala Ser Lys Leu 580 585 590 Pro Arg His Asn His 595 38593PRTCaulobacter sp. AP07 38Met Thr Ser Pro Asn Arg Thr Pro Arg Arg Phe Arg Ser Arg Asp Trp 1 5 10 15 Phe Asp Asn Pro Asp His Ile Asp Met Thr Ala Leu Tyr Leu Glu Arg 20 25 30 Phe Met Asn Tyr Gly Ile Thr Pro Glu Glu Leu Arg Ser Gly Lys Pro 35 40 45 Ile Ile Gly Ile Ala Gln Thr Gly Ser Asp Ile Ser Pro Cys Asn Arg 50 55 60 Ile His Leu Asp Leu Val Thr Arg Ile Arg Asp Gly Ile Arg Asp Ala 65 70 75 80 Gly Gly Ile Pro Met Glu Phe Pro Val His Pro Ile Phe Glu Asn Cys 85 90 95 Arg Arg Pro Thr Ala Ala Leu Asp Arg Asn Leu Ser Tyr Leu Gly Leu 100 105 110 Val Glu Thr Leu His Gly Tyr Pro Ile Asp Ala Val Val Leu Thr Thr 115 120 125 Gly Cys Asp Lys Thr Thr Pro Ala Gly Ile Met Ala Ala Thr Thr Val 130 135 140 Asn Ile Pro Ala Ile Val Leu Ser Gly Gly Pro Met Leu Asp Gly Trp 145 150 155 160 His Asp Gly Glu Leu Val Gly Ser Gly Thr Val Ile Trp Arg Ser Arg 165 170 175 Arg Lys Leu Ala Ala Gly Glu Ile Thr Glu Glu Glu Phe Ile Gln Arg 180 185 190 Ala Ser Asp Ser Ala Pro Ser Ala Gly His Cys Asn Thr Met Gly Thr 195 200 205 Ala Ser Thr Met Asn Ala Val Ala Glu Ala Leu Gly Leu Ser Leu Thr 210 215 220 Gly Cys Ala Ala Ile Pro Ala Pro Tyr Arg Glu Arg Gly Gln Met Ala 225 230 235 240 Tyr Arg Thr Gly Gln Arg Ile Val Asp Leu Ala Tyr Glu Asp Ile Lys 245 250 255 Pro Lys Asp Ile Leu Thr Lys Gln Ala Phe Glu Asn Ala Ile Ala Leu 260 265 270 Val Ala Ala Ala Gly Gly Ser Thr Asn Ala Gln Pro His Ile Val Ala 275 280 285 Met Ala Arg His Ala Gly Leu Asp Val Thr Ala Asp Asp Trp Arg Ala 290 295 300 Ala Tyr Asp Ile Pro Leu Ile Leu Asn Met Gln Pro Ala Gly Lys Tyr 305 310 315 320 Leu Gly Glu Arg Phe His Arg Ala Gly Gly Ala Pro Ala Val Leu Trp 325 330 335 Glu Leu Leu Gln Ala Gly Arg Leu His Gly Asp Ala Met Thr Val Thr 340 345 350 Gly Lys Thr Met Ala Glu Asn Leu Glu Gly Arg Glu Thr Arg Asp Arg 355 360 365 Glu Val Val Phe Pro Tyr Ala Ala Pro Met Ser Glu Arg Ala Gly Phe 370 375 380 Leu Val Leu Lys Gly Asn Leu Phe Asp Phe Ala Ile Met Lys Thr Ser 385 390 395 400 Val Ile Ser Gln Glu Phe Arg Asp Arg Tyr Leu Ser Glu Pro Gly Gln 405 410 415 Glu Gly Ala Phe Glu Ala Arg Ala Val Val Phe Asp Gly Ser Gly Asp 420 425 430 Tyr His Ala Arg Ile Asn Asp Pro Ser Leu Gly Ile Asp Glu Arg Thr 435 440 445 Ile Leu Val Ile Arg Gly Ala Gly Pro Ile Gly Trp Pro Gly Ser Ala 450 455 460 Glu Val Val Asn Met Gln Pro Pro Asp Ala Leu Leu Lys Lys Gly Ile 465 470 475 480 Met Ser Leu Pro Thr Leu Gly Asp Gly Arg Gln Ser Gly Thr Ala Asp 485 490 495 Ser Pro Ser Ile Leu Asn Ala Ser Pro Glu Ser Ala Val Gly Gly Gly 500 505 510 Leu Ser Trp Leu Arg Thr Gly Asp Val Ile Arg Ile Asp Leu Asn Thr 515 520 525 Gly Arg Cys Asp Ala Leu Val Asp Glu Ala Thr Ile Ala Ala Arg Lys 530 535 540 Leu Glu Gly Leu Pro Pro Val Pro Glu Thr Met Thr Pro Trp Gln Glu 545 550 555 560 Ile Tyr Arg Ala His Thr Gly Gln Leu Glu Thr Gly Gly Val Leu Glu 565 570 575 Phe Ala Val Lys Tyr Gln Asp Leu Ala Ala Lys Leu Pro Arg His Asn 580 585 590 His 39591PRTCaulobacter segnis 39Met Ser Glu Arg Thr Pro Arg Arg Phe Arg Ser Arg Asp Trp Phe Asp 1 5 10 15 Asn Pro Asp His Ile Asp Met Thr Ala Leu Tyr Leu Glu Arg Phe Met 20 25 30 Asn Tyr Gly Ile Thr Pro Glu Glu Leu Arg Ser Gly Lys Pro Ile Ile 35 40 45 Gly Ile Ala Gln Thr Gly Ser Asp Ile Ser Pro Cys Asn Arg Ile His 50 55 60 Leu Asp Leu Val Thr Arg Ile Arg Asp Gly Ile Arg Asp Ala Gly Gly 65 70 75 80 Ile Pro Met Glu Phe Pro Val His Pro Ile Phe Glu Asn Cys Arg Arg 85 90 95 Pro Thr Ala Ala Leu Asp Arg Asn Leu Ser Tyr Leu Gly Leu Val Glu 100 105 110 Thr Leu His Gly Tyr Pro Ile Asp Ala Val Val Leu Thr Thr Gly Cys 115 120 125 Asp Lys Thr Thr Pro Ala Gly Ile Met Ala Ala Thr Thr Val Asn Ile 130 135 140 Pro Ala Ile Val Leu Ser Gly Gly Pro Met Leu Asp Gly Trp His Glu 145 150 155 160 Gly Glu Leu Val Gly Ser Gly Thr Val Ile Trp Arg Ser Arg Arg Lys 165 170 175 Leu Ala Ala Gly Glu Ile Thr Glu Glu Glu Phe Ile Asp Arg Ala Ala 180 185 190 Ser Ser Ala Pro Ser Ala Gly His Cys Asn Thr Met Gly Thr Ala Ser 195 200 205 Thr Met Asn Ala Val Ala Glu Ala Leu Gly Leu Ser Leu Thr Gly Cys 210 215 220 Ala Ala Ile Pro Ala Pro Tyr Arg Glu Arg Gly Gln Met Ala Tyr Lys 225 230 235 240 Thr Gly Gln Arg Ile Val Asp Leu Ala Tyr Glu Asp Val Lys Pro Leu 245 250 255 Asp Ile Leu Thr Lys Lys Ala Phe Gln Asn Ala Ile Ala Leu Val Ala 260 265 270 Ala Ala Gly Gly Ser Thr Asn Ala Gln Pro His Ile Val Ala Met Ala 275 280 285 Arg His Ala Gly Val Glu Ile Thr Ala Asp Asp Trp Arg Ala Ala Tyr 290 295 300 Asp Ile Pro Leu Ile Val Asn Met Gln Pro Ala Gly Lys Tyr Leu Gly 305 310 315 320 Glu Arg Phe His Arg Ala Gly Gly Ala Pro Ala Val Leu Trp Glu Leu 325 330 335 Leu Gln Gln Gly Arg Leu His Gly Asp Val Leu Thr Val Thr Gly Lys 340 345 350 Thr Met Gly Glu Asn Leu Gln Gly Arg Glu Thr Ser Asp Arg Glu Val 355 360 365 Ile Phe Pro Tyr His Gln Pro Leu Ala Glu Lys Ala Gly Phe Leu Val 370 375 380 Leu Lys Gly Asn Leu Phe Asp Phe Ala Ile Met Lys Ser Ser Val Ile 385 390 395 400 Gly Glu Glu Phe Arg Lys Arg Tyr Leu Ser Glu Pro Gly Lys Glu Gly 405 410 415 Val Phe Glu Ala Arg Ala Ile Val Phe Asp Gly Ser Asp Asp Tyr His 420 425 430 Lys Arg Ile Asn Asp Pro Ala Leu Glu Ile Asp Glu Arg Cys Ile Leu 435 440 445 Val Ile Arg Gly Ala Gly Pro Ile Gly Trp Pro Gly Ser Ala Glu Val 450 455 460 Val Asn Met Gln Pro Pro Asp His Leu Leu Lys Lys Gly Ile Met Ser 465 470 475 480 Leu Pro Thr Leu Gly Asp Gly Arg Gln Ser Gly Thr Ala Asp Ser Pro 485 490 495 Ser Ile Leu Asn Ala Ser Pro Glu Ser Ala Ile Gly Gly Gly Leu Ser 500 505 510 Trp Leu Arg Thr Gly Asp Thr Ile Arg Ile Asp Ile Asn Thr Gly Arg 515 520 525 Cys Asp Ala Leu Val Asp Glu Ala Thr Ile Ala Glu Arg Lys Lys Glu 530 535 540 Gly Ile Pro Ala Val Pro Ala Thr Met Thr Pro Trp Gln Glu Ile Tyr 545 550 555 560 Arg Ala His Thr Gly Gln Leu Glu Ser Gly Gly Val Leu Glu Phe Ala 565 570 575 Val Lys Tyr Gln Asp Leu Ala Ser Lys Leu Pro Arg His Asn His 580 585 590 40591PRTCaulobacter crescentus 40Met Ser Asn Arg Thr Pro Arg Arg Phe Arg Ser Arg Asp Trp Phe Asp 1 5 10 15 Asn Pro Asp His Ile Asp Met Thr Ala Leu Tyr Leu Glu Arg Phe Met 20 25 30 Asn Tyr Gly Ile Thr Pro Glu Glu Leu Arg Ser Gly Lys Pro Ile Ile 35 40 45 Gly Ile Ala Gln Thr Gly Ser Asp Ile Ser Pro Cys Asn Arg Ile His 50 55 60 Leu Asp Leu Val Gln Arg Val Arg Asp Gly Ile Arg Asp Ala Gly Gly 65 70 75 80 Ile Pro Met Glu Phe Pro Val His Pro Ile Phe Glu Asn Cys Arg Arg 85 90 95 Pro Thr Ala Ala Leu Asp Arg Asn Leu Ser Tyr Leu Gly Leu Val Glu 100 105 110 Thr Leu His Gly Tyr Pro Ile Asp Ala Val Val Leu Thr Thr Gly Cys 115 120 125 Asp Lys Thr Thr Pro Ala Gly Ile Met Ala Ala Thr Thr Val Asn Ile 130 135 140 Pro Ala Ile Val Leu Ser Gly Gly Pro Met Leu Asp Gly Trp His Glu 145 150 155 160 Asn Glu Leu Val Gly Ser Gly Thr Val Ile Trp Arg Ser Arg Arg Lys 165 170 175 Leu Ala Ala Gly Glu Ile Thr Glu Glu Glu Phe Ile Asp Arg Ala Ala 180 185 190 Ser Ser Ala Pro Ser Ala Gly His Cys Asn Thr Met Gly Thr Ala Ser 195 200 205 Thr Met Asn Ala Val Ala Glu Ala Leu Gly Leu Ser Leu Thr Gly Cys 210 215 220 Ala Ala Ile Pro Ala Pro Tyr Arg Glu Arg Gly Gln Met Ala Tyr Lys 225 230 235 240 Thr Gly Gln Arg Ile Val Asp Leu Ala Tyr Asp Asp Val Lys Pro Leu 245 250 255 Asp Ile Leu Thr Lys Gln Ala Phe Glu Asn Ala Ile Ala Leu Val Ala 260 265 270 Ala Ala Gly Gly Ser Thr Asn Ala Gln Pro His Ile Val Ala Met Ala 275 280 285 Arg His Ala Gly Val Glu Ile Thr Ala Asp Asp Trp Arg Ala Ala Tyr 290 295 300 Asp Ile Pro Leu Ile Val Asn Met Gln Pro Ala Gly Lys Tyr Leu Gly 305 310 315 320 Glu Arg Phe His Arg Ala Gly Gly Ala Pro Ala Val Leu Trp Glu Leu 325 330 335 Leu Gln Gln Gly Arg Leu His Gly Asp Val Leu Thr Val Thr Gly Lys 340 345 350 Thr Met Ser Glu Asn Leu Gln Gly Arg Glu Thr Ser Asp Arg Glu Val 355 360 365 Ile Phe Pro Tyr His Glu Pro Leu Ala Glu Lys Ala Gly Phe Leu Val 370 375 380 Leu Lys Gly Asn Leu Phe Asp Phe Ala Ile Met Lys Ser Ser Val Ile 385 390 395 400 Gly Glu Glu Phe Arg Lys Arg Tyr Leu Ser Gln Pro Gly Gln Glu Gly 405 410 415 Val Phe Glu Ala Arg Ala Ile Val Phe Asp Gly Ser Asp Asp Tyr His 420 425 430 Lys Arg Ile Asn Asp Pro Ala Leu Glu Ile Asp Glu Arg Cys Ile Leu 435 440 445 Val Ile Arg Gly Ala Gly Pro Ile Gly Trp Pro Gly Ser Ala Glu Val 450 455 460 Val Asn Met Gln Pro Pro Asp His Leu Leu Lys Lys Gly Ile Met Ser 465 470 475 480 Leu Pro Thr Leu Gly Asp Gly Arg Gln Ser Gly Thr Ala Asp Ser Pro 485 490 495 Ser Ile Leu Asn Ala Ser Pro Glu Ser Ala Ile Gly Gly Gly Leu Ser 500 505 510 Trp Leu Arg Thr Gly Asp Thr Ile Arg Ile Asp Leu Asn Thr Gly Arg 515 520 525 Cys Asp Ala Leu Val Asp Glu Ala Thr Ile Ala Ala Arg Lys Gln Asp 530 535 540 Gly Ile Pro Ala Val Pro Ala Thr Met Thr Pro Trp Gln Glu Ile Tyr 545 550 555 560 Arg Ala His Ala Ser Gln Leu Asp Thr Gly Gly Val Leu Glu Phe Ala 565 570 575 Val Lys Tyr Gln Asp Leu Ala Ala Lys Leu Pro Arg His Asn His 580 585 590 41442PRTCaulobacter crescentus 41Met Val Cys Arg Arg Leu Leu Ala Trp Thr Ala Arg Ala Arg Glu Ala 1 5 10 15 Glu Asp Phe Ala Leu Val Arg Gln Pro Thr Cys Arg Pro His Met Leu 20 25 30 Ala Leu Pro Ser Ala Asp Glu Arg Ala Pro Pro Thr Val Ser Ala Leu 35 40 45 Gln Thr Leu Glu Phe Trp Gly Asp Asp Ala Val Gly Val Ser Glu Phe 50 55 60 Leu Pro Glu Asp Trp Lys Ala Ala Thr Leu Leu Gly Arg Ile Asp Phe 65 70 75 80 Gly Glu Gly Pro Thr Pro Val Leu Val Arg Gly Gly Arg Val Glu Asp 85 90 95 Val Ser Lys Ile Ala Pro Thr Val Ala Asp Leu Met Asn Ala Phe Gln 100 105 110 Pro Gly Ala Val Ile Pro Arg Gly Glu Asp Lys Gly Pro Leu Glu Ala 115 120 125 Leu Asp Ile Arg Pro Val Trp Glu Asp Pro Asp Gly Ala Ala Pro Val 130 135 140 Lys Leu Leu Ala Pro Val Asp Leu Gln Cys Leu Lys Ala Ala Gly Val 145 150 155 160 Thr Phe Ala Val Ser Thr Leu Glu Arg Val Ile Glu Glu Arg Ala Arg 165 170 175 Gly Asp Ala Gly Glu Ala Leu Lys Ile Arg Thr Leu Leu Ala Glu Arg 180 185 190 Met Gly Gly Asp Leu Lys Ser Val Glu Pro Gly Ser Gln Gly Ala Gln 195 200 205 Arg Leu Lys Asp Ala Leu Ile Ala Asp Gly Leu Trp Ser Gln Tyr Leu 210 215 220 Glu Val Ala Ile Gly Pro Asp Ala Glu Ile Phe Thr Lys Gly Pro Thr 225 230 235 240 Leu Ser Ser Met Gly Trp Gly Asp Gln Val Gly Val Arg Tyr Asp Ser 245 250 255 His Trp Asn Asn Pro Glu Pro Glu Val Val Leu Leu Cys Asp Gly Ser 260 265 270 Gly Leu Ile Arg Gly Ala Ala Leu Gly Asn Asp Val Asn Leu Arg Asp 275 280 285 Phe Glu Gly Arg Ser Ala Leu Leu Leu Ser Lys Ala Lys Asp Asn Asn 290 295 300 Ala Ser Cys Ala Ile Gly Pro Phe Phe Arg Leu Phe Asp Glu Thr Phe 305 310 315 320 Gly Leu Asp Asp Val Arg Ser Ala Glu Val Glu Leu Lys Ile Thr Gly 325 330 335 Arg Asp Asn Phe Val Leu Asp Gly Lys Ser Asn Met Ser Leu Ile Ser

340 345 350 Arg Asp Pro Ala Val Leu Ala Gly Gln Ala Tyr Gly Lys Gln His Gln 355 360 365 Tyr Pro Asp Gly Phe Ala Leu Phe Leu Gly Thr Met Phe Ala Pro Ile 370 375 380 Gln Asp Arg Asp Thr Pro Gly Gln Gly Phe Thr His Lys Val Gly Asp 385 390 395 400 Arg Val Arg Val Ser Thr Pro Lys Leu Gly Val Leu Glu Asn Glu Val 405 410 415 Thr Thr Cys Asp Lys Ala Lys Pro Trp Thr Phe Gly Ile Ser Ala Leu 420 425 430 Ile Arg Asn Leu Ala Gly Arg Gly Leu Leu 435 440 42384PRTCaulobacter crescentus 42Met Gly Val Ser Glu Phe Leu Pro Glu Asp Trp Lys Ala Ala Thr Leu 1 5 10 15 Leu Gly Arg Ile Asp Phe Gly Glu Gly Pro Thr Pro Val Leu Val Arg 20 25 30 Gly Gly Arg Val Glu Asp Val Ser Lys Ile Ala Pro Thr Val Ala Asp 35 40 45 Leu Met Asn Ala Phe Gln Pro Gly Ala Val Ile Pro Arg Gly Glu Asp 50 55 60 Lys Gly Pro Leu Glu Ala Leu Asp Ile Arg Pro Val Trp Glu Asp Pro 65 70 75 80 Asp Gly Ala Ala Pro Val Lys Leu Leu Ala Pro Val Asp Leu Gln Cys 85 90 95 Leu Lys Ala Ala Gly Val Thr Phe Ala Val Ser Thr Leu Glu Arg Val 100 105 110 Ile Glu Glu Arg Ala Arg Gly Asp Ala Gly Glu Ala Leu Lys Ile Arg 115 120 125 Thr Leu Leu Ala Glu Arg Met Gly Gly Asp Leu Lys Ser Val Glu Pro 130 135 140 Gly Ser Gln Gly Ala Gln Arg Leu Lys Asp Ala Leu Ile Ala Asp Gly 145 150 155 160 Leu Trp Ser Gln Tyr Leu Glu Val Ala Ile Gly Pro Asp Ala Glu Ile 165 170 175 Phe Thr Lys Gly Pro Thr Leu Ser Ser Met Gly Trp Gly Asp Gln Val 180 185 190 Gly Val Arg Tyr Asp Ser His Trp Asn Asn Pro Glu Pro Glu Val Val 195 200 205 Leu Leu Cys Asp Gly Ser Gly Leu Ile Arg Gly Ala Ala Leu Gly Asn 210 215 220 Asp Val Asn Leu Arg Asp Phe Glu Gly Arg Ser Ala Leu Leu Leu Ser 225 230 235 240 Lys Ala Lys Asp Asn Asn Ala Ser Cys Ala Ile Gly Pro Phe Phe Arg 245 250 255 Leu Phe Asp Glu Thr Phe Gly Leu Asp Asp Val Arg Ser Ala Glu Val 260 265 270 Glu Leu Lys Ile Thr Gly Arg Asp Asn Phe Val Leu Asp Gly Lys Ser 275 280 285 Asn Met Ser Leu Ile Ser Arg Asp Pro Ala Val Leu Ala Gly Gln Ala 290 295 300 Tyr Gly Lys Gln His Gln Tyr Pro Asp Gly Phe Ala Leu Phe Leu Gly 305 310 315 320 Thr Met Phe Ala Pro Ile Gln Asp Arg Asp Thr Pro Gly Gln Gly Phe 325 330 335 Thr His Lys Val Gly Asp Arg Val Arg Val Ser Thr Pro Lys Leu Gly 340 345 350 Val Leu Glu Asn Glu Val Thr Thr Cys Asp Lys Ala Lys Pro Trp Thr 355 360 365 Phe Gly Ile Ser Ala Leu Ile Arg Asn Leu Ala Gly Arg Gly Leu Leu 370 375 380 43384PRTCaulobacter segnis 43Met Gly Val Ser Glu Phe Leu Pro Asp Asp Trp Lys Asn Ala Thr Leu 1 5 10 15 Leu Gly Arg Ile Asp Phe Gly Glu Gly Pro Thr Pro Val Leu Val Arg 20 25 30 Gly Gly Arg Val Glu Asp Met Ser Lys Val Ala Pro Thr Val Ala Asp 35 40 45 Leu Met Asn Ala Phe Gly Pro Gly Ala Ala Ile Pro Arg Gly Glu Asp 50 55 60 Lys Gly Pro Leu Glu Ser Leu Asp Ile Arg Pro Val Trp Glu Asp Pro 65 70 75 80 Asp Gly Ala Ala Pro Val Lys Leu Leu Ala Pro Val Asp Leu Gln Cys 85 90 95 Leu Lys Ala Ala Gly Val Thr Phe Ala Val Ser Thr Leu Glu Arg Val 100 105 110 Ile Glu Glu Arg Ala Arg Gly Asp Ala Ala Ala Ala Leu Lys Ile Arg 115 120 125 Glu Gln Leu Ser Ala Ser Met Gly Gly Asp Leu Arg Ser Val Asn Pro 130 135 140 Gly Ser Glu Gly Ala Glu Arg Leu Lys Gln Thr Leu Ile Lys Asp Gly 145 150 155 160 Leu Trp Ser Gln Tyr Leu Glu Val Ala Ile Gly Pro Asp Ala Glu Ile 165 170 175 Phe Thr Lys Gly Pro Thr Leu Ser Ser Met Gly Trp Gly Asp His Val 180 185 190 Gly Val Arg Tyr Asp Ser His Trp Asn Asn Pro Glu Pro Glu Val Val 195 200 205 Leu Leu Cys Asp Gly Ala Gly Gln Ile Arg Gly Ala Ser Leu Gly Asn 210 215 220 Asp Val Asn Leu Arg Asp Phe Glu Gly Arg Ser Ala Leu Leu Leu Ser 225 230 235 240 Lys Ala Lys Asp Asn Asn Ala Ser Cys Ala Ile Gly Pro Phe Phe Arg 245 250 255 Leu Phe Asp Glu Thr Phe Ala Leu Asp Asp Val Arg Ser Ala Glu Val 260 265 270 Glu Leu Lys Ile Thr Gly Arg Asp Asn Phe Val Leu Asp Gly Lys Ser 275 280 285 Asn Met Ser Leu Ile Ser Arg Asp Pro Ala Val Leu Ala Gly Gln Ala 290 295 300 Tyr Gly Lys Gln His Gln Tyr Pro Asp Gly Phe Ala Leu Phe Leu Gly 305 310 315 320 Thr Met Phe Ala Pro Ile Gln Asp Arg Asp Thr Pro Gly Gln Gly Phe 325 330 335 Thr His Lys Val Gly Asp Arg Val Arg Val Ser Thr Pro Lys Leu Gly 340 345 350 Val Leu Glu Asn Glu Val Thr Thr Cys Asp Lys Ala Lys Pro Trp Thr 355 360 365 Phe Gly Ile Ser Ala Leu Ile Arg Asn Leu Ala Gly Arg Gly Leu Leu 370 375 380 44383PRTCaulobacter sp. K31 44Met Ala Leu Ser Asp Phe Leu Pro Asp Asp Trp Arg Asp Ala Thr Leu 1 5 10 15 Leu Gly Arg Ile Asp Phe Gly Gln Gly Pro Thr Pro Val Leu Ile Arg 20 25 30 Gly Gly Arg Ile Glu Asp Val Ser Lys Ile Ala Pro Thr Thr Ser Asp 35 40 45 Leu Met Asn Ala Phe Ala Pro Gly Ala Ala Ile Pro Arg Gly Glu Asp 50 55 60 Leu Gly Pro Leu Glu Ala Leu Asp Val Arg Ala Val Trp Glu Asn Pro 65 70 75 80 Gln Gly Ala Ala Ala Lys Leu Leu Ala Pro Val Asp Leu Gln Val Leu 85 90 95 Lys Ala Ala Gly Val Thr Phe Ala Val Ser Thr Leu Glu Arg Val Ile 100 105 110 Glu Glu Arg Ala Arg Gly Asp Ala Ala Glu Ala Leu Lys Ile Arg Ala 115 120 125 Gln Leu Ala Asp Ser Met Gly Gly Asp Leu Arg Ser Val Asn Pro Gly 130 135 140 Ser Asp Gly Ala Glu Arg Leu Lys Gln Thr Leu Ile Lys Asp Gly Leu 145 150 155 160 Trp Ser Gln Tyr Leu Glu Val Ala Ile Gly Pro Asp Ala Glu Ile Phe 165 170 175 Thr Lys Gly Pro Thr Leu Ser Ser Met Gly Trp Gly Asp His Val Gly 180 185 190 Val Arg Ser Asp Ser His Trp Asn Asn Pro Glu Pro Glu Val Val Leu 195 200 205 Leu Cys Asp Gly Ser Gly Gln Ile Arg Gly Ala Ala Leu Gly Asn Asp 210 215 220 Val Asn Leu Arg Asp Phe Glu Gly Arg Ser Ala Leu Leu Leu Ser Lys 225 230 235 240 Ala Lys Asp Asn Asn Ala Ser Cys Ala Ile Gly Pro Phe Phe Arg Leu 245 250 255 Phe Asp Asp Gly Phe Ser Leu Asp Asp Val Arg Ser Ala Glu Val Thr 260 265 270 Leu Lys Ile Thr Gly Arg Asp Asn Phe Val Leu Asp Gly His Ser Asn 275 280 285 Met Ser Leu Ile Ser Arg Asp Pro Ala Val Leu Ala Gly Gln Ala Phe 290 295 300 Gly Lys Gln His Gln Tyr Pro Asp Gly Phe Ala Leu Phe Leu Gly Thr 305 310 315 320 Met Phe Ala Pro Ile Gln Asp Arg Asp Ala Ala Gly Gln Gly Phe Thr 325 330 335 His Lys Val Gly Asp Arg Val Arg Val Ala Thr Pro Lys Leu Gly Val 340 345 350 Leu Glu Asn Glu Val Thr Thr Cys Asp Leu Ala Ala Pro Trp Thr Phe 355 360 365 Gly Val Ser Ala Leu Ile Arg Asn Leu Ala Gly Arg Gly Leu Leu 370 375 380 45383PRTCaulobacter sp. AP07 45Met Ala Leu Ser Asp Phe Leu Pro Asp Asp Trp Arg Asp Ala Thr Leu 1 5 10 15 Leu Gly Arg Val Asp Phe Gly Asp Gly Pro Thr Pro Val Leu Val Arg 20 25 30 Gly Gly Arg Ile Glu Asp Val Ser Arg Ile Ala Pro Thr Thr Ser Asp 35 40 45 Leu Met Asn Ala Phe Ala Pro Gly Ala Ala Ile Pro Ala Gly Ala Asp 50 55 60 Leu Gly Pro Leu Glu Ala Leu Asp Val Arg Pro Val Trp Glu Asn Pro 65 70 75 80 Asp Gly Ala Ala Ala Lys Leu Leu Ala Pro Val Asp Leu Gln Val Leu 85 90 95 Lys Ala Ala Gly Val Thr Phe Ala Val Ser Thr Leu Glu Arg Val Ile 100 105 110 Glu Glu Arg Ala Arg Gly Asp Ala Ala Glu Ala Leu Lys Ile Arg Ala 115 120 125 Gln Leu Ala Asp Ser Met Gly Gly Asp Leu Arg Gly Val Asn Pro Gly 130 135 140 Ser Glu Gly Ala Ala Arg Leu Lys Glu Thr Leu Ile Lys Gly Gly Leu 145 150 155 160 Trp Ser Gln Tyr Leu Glu Val Ala Ile Gly Pro Asp Ala Glu Ile Phe 165 170 175 Thr Lys Gly Pro Thr Leu Ser Ser Met Gly Trp Gly Asp Gln Val Gly 180 185 190 Val Arg Ser Asp Ser His Trp Asn Asn Pro Glu Pro Glu Val Val Leu 195 200 205 Leu Cys Asp Gly Ser Gly Arg Ile Arg Gly Ala Ser Leu Gly Asn Asp 210 215 220 Val Asn Leu Arg Asp Phe Glu Gly Arg Ser Ala Leu Leu Leu Ser Lys 225 230 235 240 Ala Lys Asp Asn Asn Ala Ser Cys Ala Ile Gly Pro Phe Phe Arg Leu 245 250 255 Phe Asp Asp Gly Phe Gly Leu Asp Asp Val Arg Ser Ala Glu Val Thr 260 265 270 Leu Lys Ile Thr Gly Arg Asp Asn Phe Val Leu Asp Gly His Ser Asn 275 280 285 Met Ser Leu Ile Ser Arg Asp Pro Ala Val Leu Ala Gly Gln Ala Phe 290 295 300 Gly Lys Gln His Gln Tyr Pro Asp Gly Phe Val Leu Phe Leu Gly Thr 305 310 315 320 Met Phe Ala Pro Ile Gln Asp Arg Asp Thr Ala Gly Gln Gly Phe Thr 325 330 335 His Lys Val Gly Asp Arg Val Arg Val Ala Thr Pro Lys Leu Gly Val 340 345 350 Leu Glu Asn Glu Val Thr Thr Cys Asp Val Ala Pro Pro Trp Thr Phe 355 360 365 Gly Val Ser Ala Leu Ile Arg Asn Leu Ala Gly Arg Gly Leu Leu 370 375 380 46309PRTBurkholderia thailandensis 46Met Asn Ser Val Tyr Thr Leu Gly Leu Val Gly Ile Gly Lys Ile Ala 1 5 10 15 Arg Asp Gln His Leu Pro Ala Ile Ala Ala Glu Pro Gly Phe Asp Leu 20 25 30 Leu Ala Cys Ala Ser Arg His Ala Gln Val Arg Gly Val Arg Asn Tyr 35 40 45 Pro Asp Ile Asp Ala Leu Leu Ala Ala Glu Pro Ala Leu Asp Ala Val 50 55 60 Ser Leu Ala Ala Pro Pro Gln Val Arg Tyr Ala Gln Ala Arg Ala Ala 65 70 75 80 Leu Gly Ala Gly Lys His Val Met Leu Glu Lys Pro Pro Gly Ala Thr 85 90 95 Ala Gly Glu Ile Ala Ala Leu Arg Ala Leu Ala Arg Glu Arg Gly Arg 100 105 110 Thr Leu Phe Ala Ala Trp His Ser Arg His Ala Ser Ala Val Glu Pro 115 120 125 Ala Arg Ala Trp Leu Ala Thr Arg Thr Ile Arg Ala Val Gln Ala Arg 130 135 140 Trp Lys Glu Asp Val Arg Arg Trp His Pro Gly Gln Gln Trp Ile Trp 145 150 155 160 Glu Pro Gly Gly Leu Gly Val Phe Asp Pro Gly Ile Asn Ala Leu Ser 165 170 175 Ile Val Thr Arg Ile Leu Pro Arg Glu Leu Val Leu Arg Ala Ala Thr 180 185 190 Leu Val Val Pro Ala Asn Ala His Thr Pro Ile Ala Ala Glu Leu Asp 195 200 205 Cys Val Asp Thr Ala Gly Val Pro Val Arg Ala Glu Phe Asp Trp Arg 210 215 220 His Gly Pro Val Glu Gln Trp Asp Ile Ala Val Asp Thr Asp Gly Gly 225 230 235 240 Val Leu Ser Ile Gly Ala Gly Gly Ala Arg Leu Ser Ile Ala Gly Glu 245 250 255 Pro Val Ala Leu Pro Pro Glu Arg Glu Tyr Pro Ser Leu Tyr Ala Arg 260 265 270 Phe Arg Ala Leu Ile Gly Glu Gly Ala Ser Asp Val Asp Asp Arg Pro 275 280 285 Leu Arg Leu Val Ala Asp Ala Phe Met Ile Gly Arg Arg Ile Ala Ala 290 295 300 Asp Pro Phe Gln Arg 305 47309PRTBurkholderia thailandensis 47Met Asn Ser Val Tyr Thr Leu Gly Leu Val Gly Ile Gly Lys Ile Ala 1 5 10 15 Arg Asp Gln His Leu Pro Ala Ile Ala Ala Glu Pro Gly Phe Asp Leu 20 25 30 Leu Ala Cys Ala Ser Arg His Ala Gln Val Arg Gly Val Arg Asn Tyr 35 40 45 Pro Asp Ile Asp Ala Leu Leu Ala Ala Glu Pro Ala Leu Asp Ala Val 50 55 60 Ser Leu Ala Ala Pro Pro Gln Val Arg Tyr Ala Gln Ala Arg Ala Ala 65 70 75 80 Leu Gly Ala Gly Lys His Val Met Leu Glu Lys Pro Pro Gly Ala Thr 85 90 95 Ala Gly Glu Ile Ala Ala Leu His Ala Leu Ala Arg Glu Arg Gly Arg 100 105 110 Thr Leu Phe Ala Ala Trp His Ser Arg His Ala Ser Ala Val Glu Pro 115 120 125 Ala Arg Ala Trp Leu Ala Thr Arg Thr Ile Arg Ala Val Gln Val Arg 130 135 140 Trp Lys Glu Asp Val Arg Arg Trp His Pro Gly Gln Gln Trp Ile Trp 145 150 155 160 Glu Pro Gly Gly Leu Gly Val Phe Asp Pro Gly Ile Asn Ala Leu Ser 165 170 175 Ile Val Thr Arg Ile Leu Pro Arg Glu Leu Val Leu Arg Ala Ala Thr 180 185 190 Leu Val Val Pro Ala Asn Ala His Thr Pro Ile Ala Ala Glu Leu Asp 195 200 205 Cys Val Asp Thr Ala Gly Val Pro Val Arg Ala Glu Phe Asp Trp Arg 210 215 220 His Gly Pro Val Glu Gln Trp Asp Ile Ala Val Asp Thr Asp Gly Gly 225 230 235 240 Val Leu Ser Ile Gly Ala Gly Gly Ala Arg Leu Ser Ile Ala Gly Glu 245 250 255 Pro Val Ala Leu Pro Pro Glu Arg Glu Tyr Pro Ser Leu Tyr Ala Arg 260 265 270 Phe Arg Ala Leu Ile Gly Glu Gly Ala Ser Asp Val Asp Asp Arg Pro 275 280 285 Leu Arg Leu Val Ala Asp Ala Phe Met Ile Gly Arg Arg Ile Ala Ala 290 295 300 Asp Pro Phe Gln Arg 305 48309PRTBurkholderia ambifaria 48Met Ser Lys Val Ile Ser Leu Gly Val Ile Gly Ile Gly Lys Ile Ala 1 5 10 15 Arg Asp Gln His Leu Pro Ala Ile Ala Ala Glu Pro Gly Phe Ala

Leu 20 25 30 Thr Ala Cys Ala Ser Arg His Ala Glu Val Asn Gly Val Arg Asn Tyr 35 40 45 Pro Glu Leu Gly Ala Leu Leu Ala Ala Glu Pro Glu Leu Glu Ala Val 50 55 60 Ser Leu Cys Ala Pro Pro Gln Val Arg Tyr Ala Gln Ala Arg Ala Ala 65 70 75 80 Leu Glu Ala Gly Lys His Val Met Leu Glu Lys Pro Pro Gly Ala Thr 85 90 95 Leu Gly Glu Val Ala Ala Leu Asp Ala Leu Ala Arg Glu Arg Gly Leu 100 105 110 Thr Leu Phe Ala Thr Trp His Ser Arg Cys Ala Ser Ala Val Glu Pro 115 120 125 Ala Arg Ala Trp Leu Ala Thr Arg Thr Ile Arg Ala Val Gln Val Arg 130 135 140 Trp Lys Glu Asp Val Arg Arg Trp His Pro Gly Gln Gln Trp Ile Trp 145 150 155 160 Glu Pro Gly Gly Leu Gly Val Phe Asp Pro Gly Ile Asn Ala Leu Ser 165 170 175 Ile Val Thr Arg Ile Leu Pro Arg Glu Leu Val Leu Arg Glu Ala Thr 180 185 190 Leu Tyr Val Pro Ser Asp Val Gln Thr Pro Ile Ala Ala Glu Leu Asp 195 200 205 Cys Ala Asp Thr Asp Gly Val Pro Val His Ala Glu Phe Asp Trp Arg 210 215 220 His Gly Pro Val Glu Gln Trp Glu Ile Ala Val Asp Thr Ser Asp Gly 225 230 235 240 Val Leu Ala Ile Ser Arg Gly Gly Ala Gln Leu Ser Ile Gly Gly Glu 245 250 255 Pro Val Glu Ile Gly Pro Gln Arg Glu Tyr Pro Ala Leu Tyr Ala His 260 265 270 Phe Arg Ala Leu Ile Ala Arg Gly Glu Ser Asp Val Asp Val Arg Pro 275 280 285 Leu Arg Leu Val Ala Asp Ala Phe Leu Phe Gly Arg Arg Val Gly Thr 290 295 300 Asp Ala Phe Gly Arg 305 49309PRTBurkholderia ambifaria 49Met Ser Lys Val Ile Ser Leu Gly Val Ile Gly Ile Gly Lys Ile Ala 1 5 10 15 Arg Asp Gln His Leu Pro Ala Ile Ala Ala Glu Pro Gly Phe Ala Leu 20 25 30 Thr Ala Cys Ala Ser Arg His Ala Glu Val Asn Gly Val Arg Asn Tyr 35 40 45 Pro Glu Leu Gly Ala Leu Leu Ala Ala Glu Pro Glu Leu Glu Ala Val 50 55 60 Ser Leu Cys Ala Pro Pro Gln Val Arg Tyr Ala Gln Ala Arg Ala Ala 65 70 75 80 Leu Glu Ala Gly Lys His Val Met Leu Glu Lys Pro Pro Gly Ala Thr 85 90 95 Leu Gly Glu Val Ala Ala Leu Asp Ala Leu Ala Arg Glu Arg Gly Leu 100 105 110 Thr Leu Phe Ala Thr Trp His Ser Arg Cys Ala Ser Ala Val Glu Pro 115 120 125 Ala Arg Ala Trp Leu Ala Thr Arg Thr Ile Arg Ala Val Gln Val Arg 130 135 140 Trp Lys Glu Asp Val Arg Arg Trp His Pro Gly Gln Gln Trp Ile Trp 145 150 155 160 Glu Pro Gly Gly Leu Gly Val Phe Asp Pro Gly Ile Asn Ala Leu Ser 165 170 175 Ile Val Thr Arg Ile Leu Pro Arg Glu Leu Val Leu Arg Glu Ala Thr 180 185 190 Leu Tyr Val Pro Ser Asp Val Gln Thr Pro Ile Ala Ala Glu Leu Asp 195 200 205 Cys Ala Asp Thr Asp Gly Val Pro Val His Ala Glu Phe Asp Trp Arg 210 215 220 His Gly Pro Val Glu Gln Trp Glu Ile Ala Val Asp Thr Ser Asp Gly 225 230 235 240 Val Leu Ala Ile Ser Arg Gly Gly Ala Gln Leu Ser Ile Ala Gly Glu 245 250 255 Pro Val Glu Ile Gly Pro Gln Arg Glu Tyr Pro Ala Leu Tyr Ala His 260 265 270 Phe Arg Ala Leu Ile Ala Arg Gly Glu Ser Asp Val Asp Val Arg Pro 275 280 285 Leu Arg Leu Val Ala Asp Ala Phe Leu Phe Gly Arg Arg Val Gly Thr 290 295 300 Asp Ala Phe Gly Arg 305 50309PRTBurkholderia thailandensis 50Met Asn Thr Val Tyr Thr Leu Gly Leu Val Gly Ile Gly Lys Ile Ala 1 5 10 15 Arg Asp Gln His Leu Pro Ala Ile Ala Ala Glu Pro Gly Phe Asp Leu 20 25 30 Arg Ala Cys Ala Ser Arg His Ala Glu Val Arg Gly Val Arg Asn His 35 40 45 Pro Asp Ile Gly Ala Leu Leu Ala Ala Glu Pro Ala Leu Asp Ala Val 50 55 60 Ser Leu Ala Ala Pro Pro Gln Val Arg Tyr Ala Gln Ala Arg Ala Ala 65 70 75 80 Leu Asp Ala Gly Lys His Val Met Leu Glu Lys Pro Pro Gly Ala Thr 85 90 95 Val Gly Glu Ile Ala Ala Leu Arg Ala Leu Ala Arg Glu Arg Gly Arg 100 105 110 Thr Leu Phe Ala Ser Trp His Ser Arg His Ala Arg Ala Val Glu Pro 115 120 125 Ala Arg Ala Trp Leu Ala Thr Arg Thr Ile Arg Ala Val Gln Val Arg 130 135 140 Trp Lys Glu Asp Val Arg Arg Trp His Pro Gly Gln Gln Trp Ile Trp 145 150 155 160 Glu Pro Gly Gly Leu Gly Val Phe Asp Pro Gly Ile Asn Ala Leu Ser 165 170 175 Ile Val Thr Arg Ile Leu Pro Arg Glu Leu Val Leu Arg Ala Ala Thr 180 185 190 Leu Val Val Pro Ala Asn Val His Thr Pro Ile Ala Ala Glu Phe Asp 195 200 205 Cys Val Asp Thr Ala Gly Val Pro Val Arg Ala Glu Phe Asp Trp Arg 210 215 220 His Gly Pro Val Glu Gln Trp Asp Ile Ala Val Asp Thr Asp Gly Gly 225 230 235 240 Val Leu Ala Ile Gly Ala Gly Gly Ala Arg Leu Ser Ile Ala Gly Glu 245 250 255 Pro Val Ala Leu Pro Pro Glu Cys Glu Tyr Pro Ser Leu Tyr Ala Arg 260 265 270 Phe His Ala Leu Ile Ala Ala Arg Glu Ser Asp Val Asp Asp Arg Pro 275 280 285 Leu Arg Leu Val Ala Asp Ala Phe Met Val Gly Arg Arg Ile Ala Ala 290 295 300 Asp Pro Phe His Arg 305 51310PRTBurkholderia thailandensis 51Met Glu Ser Ser Asn Arg Pro Ala Arg Thr Gly Ala Ala Ser Ala Ala 1 5 10 15 Thr Leu Arg Val Asp Cys Arg Asn Ala Leu Gly Glu Gly Ala Thr Trp 20 25 30 Cys Asp Ala Thr Arg Ala Leu Tyr Trp Val Asp Ile Glu Gly Ala Arg 35 40 45 Leu Trp Arg Trp Arg Ala Ala Gly Ala Gln Gly Gly Ala Ala Thr Asp 50 55 60 Ser Trp Glu Met Pro Glu Arg Ile Gly Cys Phe Ala Leu Thr Asp Asp 65 70 75 80 Pro Asp Val Leu Leu Val Gly Leu Ala Ser Arg Leu Ala Phe Phe Asp 85 90 95 Ala Arg Arg Arg Ala Phe Thr Pro Ile Val Asp Val Glu Pro Asp Leu 100 105 110 Pro Thr Arg Leu Asn Asp Gly Arg Cys Asp Arg Ala Gly Ala Phe Val 115 120 125 Phe Gly Met Lys Asp Glu Gly Gly Gly Ser Pro Arg Ala Val Gly Gly 130 135 140 Tyr Tyr Arg Leu Asn Pro Asp Leu Ser Leu Gln Arg Leu Ala Leu Pro 145 150 155 160 Leu Ala Ala Ile Ala Asn Gly Ile Thr Phe Ser Pro Asp Gly Ser Ala 165 170 175 Met Tyr Phe Cys Asp Ser Pro Thr Arg Glu Ile Gln Val Cys Asp Tyr 180 185 190 Arg Pro Gly Gly Asp Val Asp Arg Ile Arg Ser Phe Val Arg Leu Ala 195 200 205 Asp Asp Cys Gly Glu Pro Asp Gly Ser Ala Val Asp Ala Asp Gly Gly 210 215 220 Val Trp Asn Ala Gln Trp Gly Gly Ala Arg Ile Val Arg Tyr Asp Ala 225 230 235 240 Gln Gly Val Glu Thr Glu Arg Ile Ala Val Pro Thr Pro Gln Pro Ser 245 250 255 Cys Val Ala Leu Asp Asp Gly Gly Arg Leu Tyr Val Thr Ser Ala Arg 260 265 270 Val Gly Leu Asp Asp Gly Ala Leu Ala Arg Ser Pro Gly Ala Gly Gly 275 280 285 Val Phe Val Ala Asp Thr Arg His Ala Gly Leu Ala Thr Ser Arg Phe 290 295 300 Ala Leu Ala Arg Asn Ala 305 310 52310PRTBurkholderia thailandensis 52Met Glu Ser Ser Ser Arg Pro Ala Arg Thr Gly Ala Ala Ser Ala Ala 1 5 10 15 Thr Leu Arg Val Asp Cys Arg Asn Ala Leu Gly Glu Gly Ala Thr Trp 20 25 30 Cys Asp Ala Thr Arg Ala Leu Tyr Trp Val Asp Ile Glu Gly Ala Arg 35 40 45 Leu Trp Arg Trp Arg Ala Ala Gly Ala Gln Gly Gly Ala Ala Thr Asp 50 55 60 Ser Trp Glu Met Pro Glu Arg Ile Gly Cys Phe Ala Leu Thr Asp Asp 65 70 75 80 Pro Asp Val Leu Leu Val Gly Leu Ala Ser Arg Leu Ala Phe Phe Asp 85 90 95 Ala Arg Arg Arg Ala Phe Thr Pro Ile Val Asp Val Glu Pro Asp Leu 100 105 110 Pro Thr Arg Leu Asn Asp Gly Arg Cys Asp Arg Ala Gly Ala Phe Val 115 120 125 Phe Gly Met Lys Asp Glu Gly Gly Gly Ser Pro Arg Ala Val Gly Gly 130 135 140 Tyr Tyr Arg Leu Asn Pro Asp Leu Ser Leu Gln Arg Leu Ala Leu Pro 145 150 155 160 Pro Ala Ala Ile Ala Asn Gly Ile Ala Phe Ser Pro Asp Gly Ser Ala 165 170 175 Met Tyr Phe Cys Asp Ser Pro Thr Arg Glu Ile Gln Val Cys Asp Tyr 180 185 190 Arg Pro Gly Gly Asp Val Asp Arg Ile Arg Pro Phe Val Arg Leu Ala 195 200 205 Asp Asp Cys Gly Glu Pro Asp Gly Ser Thr Val Asp Ala Asp Gly Gly 210 215 220 Val Trp Ser Ala Gln Trp Gly Gly Ala Arg Ile Val Arg Tyr Asp Ala 225 230 235 240 Gln Gly Val Glu Thr Glu Arg Ile Ala Val Pro Thr Pro Gln Pro Ser 245 250 255 Cys Val Ala Leu Asp Asp Gly Gly Arg Leu Tyr Val Thr Ser Ala Arg 260 265 270 Val Gly Leu Asp Asp Gly Ala Leu Ala Arg Ser Pro Gly Ala Gly Gly 275 280 285 Val Phe Val Ala Asp Thr Arg His Ala Gly Leu Ala Thr Ser Arg Phe 290 295 300 Ala Leu Ala Arg Asn Ala 305 310 53300PRTBurkholderia thailandensis 53Met Glu Ser Ser Asn Arg Pro Ala Arg Thr Gly Ala Ala Ser Ala Ala 1 5 10 15 Thr Leu Arg Val Asp Cys Arg Asn Ala Leu Gly Glu Gly Ala Thr Trp 20 25 30 Cys Asp Ala Thr Arg Ala Leu Tyr Trp Val Asp Ile Glu Gly Ala Arg 35 40 45 Leu Trp Arg Trp Arg Ala Ala Gly Ala Gln Gly Gly Ala Ala Thr Asp 50 55 60 Ser Trp Glu Met Pro Glu Arg Ile Gly Cys Phe Ala Leu Thr Asp Asp 65 70 75 80 Pro Asp Val Leu Leu Val Gly Leu Ala Ser Arg Leu Ala Phe Phe Asp 85 90 95 Ala Arg Arg Arg Ala Phe Thr Pro Ile Val Asp Val Glu Pro Asp Leu 100 105 110 Pro Thr Arg Leu Asn Asp Gly Arg Cys Asp Arg Ala Gly Ala Phe Val 115 120 125 Phe Gly Met Lys Asp Glu Gly Gly Gly Ser Pro Arg Ala Val Gly Gly 130 135 140 Tyr Tyr Arg Leu Asn Pro Asp Leu Ser Leu Gln Arg Leu Ala Leu Pro 145 150 155 160 Leu Ala Ala Ile Ala Asn Gly Ile Ala Phe Ser Pro Asp Gly Ser Ala 165 170 175 Met Tyr Phe Cys Asp Ser Pro Thr Arg Glu Ile Gln Val Cys Asp Tyr 180 185 190 Arg Pro Gly Gly Asp Val Asp Arg Ile Arg Ser Phe Val Arg Leu Ala 195 200 205 Asp Asp Cys Gly Glu Pro Asp Gly Ser Ala Val Asp Ala Asp Gly Gly 210 215 220 Val Trp Asn Ala Gln Trp Gly Gly Ala Arg Ile Val Arg Tyr Asp Ala 225 230 235 240 Gln Gly Val Glu Thr Glu Arg Ile Ala Val Pro Thr Pro Gln Pro Ser 245 250 255 Cys Val Ala Leu Asp Asp Gly Gly Arg Leu Tyr Val Thr Ser Ala Arg 260 265 270 Val Gly Leu Asp Asp Gly Ala Leu Ala Arg Ser Pro Gly Ala Gly Gly 275 280 285 Val Phe Val Ala Asp Thr Arg His Ala Gly Leu Ala 290 295 300 54311PRTBurkholderia pseudomallei 54Met Glu Ser Ser Asn Arg Pro Ala Arg Thr His Glu Ala Ser Ala Ala 1 5 10 15 Thr Leu Leu Val Asp Cys Arg Asn Ala Leu Gly Glu Gly Ala Thr Trp 20 25 30 Cys Asp Ala Ala His Ala Leu Tyr Trp Val Asp Ile Glu Gly Ala Arg 35 40 45 Leu Trp Arg Trp Arg Ala Ala Gly Ala His Gly Gly Glu Arg Cys Asp 50 55 60 Ser Trp Glu Met Pro Glu Arg Ile Ala Cys Phe Ala Leu Thr Gly Asp 65 70 75 80 Pro Asp Val Leu Leu Val Gly Leu Ala Ser Arg Leu Ala Phe Phe Asp 85 90 95 Thr Arg Arg Arg Ala Leu Thr Pro Ile Val Asp Val Glu Pro Asp Arg 100 105 110 Pro Thr Arg Leu Asn Asp Gly Arg Cys Asp Arg Ala Gly Ala Phe Val 115 120 125 Phe Gly Thr Lys Asp Glu Ser Gly Gly Ala Ser Pro Arg Ala Ile Gly 130 135 140 Gly Tyr Tyr Arg Leu Asn Ala Asp Leu Ser Leu Gln Arg Leu Ala Leu 145 150 155 160 Pro Pro Ala Ala Ile Ala Asn Gly Ile Ala Phe Ser Pro Asp Gly Ser 165 170 175 Ala Met Tyr Phe Cys Asp Ser Pro Thr Arg Glu Ile Gln Val Cys Asp 180 185 190 Tyr Arg Pro Gly Gly Asp Val Asp Arg Val Arg Ser Phe Val Arg Leu 195 200 205 Ala Asp Ala His Gly Glu Pro Asp Gly Ser Thr Val Asp Ala Ser Gly 210 215 220 Gly Val Trp Asn Ala Gln Trp Gly Gly Ala Arg Val Val Arg Tyr Asp 225 230 235 240 Ala Gln Gly Val Glu Thr Asp Arg Ile Ala Val Pro Thr Pro Gln Pro 245 250 255 Ser Cys Val Thr Leu Asp Ala Ala Gly Arg Leu Tyr Val Thr Ser Ala 260 265 270 Arg Val Gly Leu Asp Asp Gly Ala Leu Ala Gly Asn Pro Gly Ala Gly 275 280 285 Gly Val Phe Val Ala His Thr Arg His Ser Gly Ser Ala Thr Pro Arg 290 295 300 Phe Ala Leu Ala Arg His Ala 305 310 55311PRTBurkholderia pseudomallei 55Met Glu Ser Ser Asn Arg Pro Ala Arg Thr His Glu Ala Ser Ala Ala 1 5 10 15 Thr Leu Leu Val Asp Cys Arg Asn Ala Leu Gly Glu Gly Ala Thr Trp 20 25 30 Cys Asp Ala Ala His Ala Leu Tyr Trp Val Asp Ile Glu Gly Ala Arg 35 40 45 Leu Trp Arg Trp Arg Ala Ala Gly Ala His Gly Gly Glu Arg Cys Asp 50 55 60 Ser Trp Glu Met Pro Glu Arg Ile Ala Cys Phe Ala Leu Thr Gly Asp 65 70 75 80 Pro Asp Val Leu Leu Val Gly Leu Ala Ser Arg Leu Ala Phe Phe Asp 85 90 95 Thr Arg Arg Arg Ala Leu Thr Pro Ile Val Asp Val Glu Pro Asp Arg 100 105 110 Pro Thr Arg Leu Asn Asp Gly Arg Cys Asp Arg Ala Gly Ala Phe Val 115 120 125 Phe Gly Thr Lys Asp Glu Ser Gly Gly Ala Ser Pro Arg Ala Ile Gly 130

135 140 Gly Tyr Tyr Arg Leu Asn Ala Asp Leu Ser Leu Gln Arg Leu Ala Leu 145 150 155 160 Pro Pro Ala Ala Ile Ala Asn Gly Ile Ala Phe Ser Pro Asp Gly Ser 165 170 175 Ala Met Tyr Phe Cys Asp Ser Pro Thr Arg Glu Ile Gln Val Cys Asp 180 185 190 Tyr Arg Pro Gly Gly Asp Val Asp Arg Val Arg Ser Phe Val Arg Leu 195 200 205 Ala Asp Glu His Gly Glu Pro Asp Gly Ser Thr Val Asp Ala Ser Gly 210 215 220 Gly Val Trp Asn Ala Gln Trp Gly Gly Ala Arg Val Val Arg Tyr Asp 225 230 235 240 Ala Gln Gly Val Glu Thr Asp Arg Ile Ala Val Pro Thr Pro Gln Pro 245 250 255 Ser Cys Val Thr Leu Asp Ala Ala Gly Arg Leu Tyr Val Thr Ser Ala 260 265 270 Arg Val Gly Leu Asp Asp Gly Ala Leu Ala Gly Asn Pro Gly Ala Gly 275 280 285 Gly Val Phe Val Ala His Thr Arg His Pro Gly Gly Ala Thr Pro Arg 290 295 300 Phe Ala Leu Ala Arg His Ala 305 310 56583PRTBurkholderia thailandensis 56Met Ser Ala Ser Lys Pro Lys Leu Arg Ser Ala Gln Trp Phe Gly Thr 1 5 10 15 His Asp Lys Asn Gly Phe Met Tyr Arg Ser Trp Met Lys Asn Gln Gly 20 25 30 Ile Pro Asp His Glu Phe Asp Gly Arg Pro Ile Val Gly Ile Cys Asn 35 40 45 Thr Trp Ser Glu Leu Thr Pro Cys Asn Ala His Phe Arg Lys Leu Ala 50 55 60 Glu His Val Lys Arg Gly Val Tyr Glu Ala Gly Gly Phe Pro Val Glu 65 70 75 80 Phe Pro Val Phe Ser Asn Gly Glu Ser Asn Leu Arg Pro Ser Ala Met 85 90 95 Leu Thr Arg Asn Leu Ala Ser Met Asp Val Glu Glu Ala Ile Arg Gly 100 105 110 Asn Pro Ile Asp Ala Val Val Leu Leu Ala Gly Cys Asp Lys Thr Thr 115 120 125 Pro Ala Leu Leu Met Gly Ala Ala Ser Cys Asp Val Pro Ala Ile Val 130 135 140 Val Ser Gly Gly Pro Met Leu Asn Gly Lys Leu Asp Gly Lys Asn Ile 145 150 155 160 Gly Ser Gly Thr Ala Val Trp Gln Leu His Glu Ala Leu Lys Ala Gly 165 170 175 Glu Ile Asp Leu His Arg Phe Leu Ser Ala Glu Ala Gly Met Ser Arg 180 185 190 Ser Ala Gly Thr Cys Asn Thr Met Gly Thr Ala Ser Thr Met Ala Cys 195 200 205 Leu Ala Glu Ala Leu Gly Val Ala Leu Pro His Asn Ala Ala Ile Pro 210 215 220 Ala Val Asp Ala Arg Arg Tyr Val Leu Ala His Met Ser Gly Met Arg 225 230 235 240 Ile Val Gly Met Ala His Glu Gly Leu Val Leu Ser Lys Ile Leu Thr 245 250 255 Arg Ala Ala Phe Glu Asn Ala Ile Arg Val Asn Ala Ala Ile Gly Gly 260 265 270 Ser Thr Asn Ala Val Ile His Leu Lys Ala Ile Ala Gly Arg Leu Gly 275 280 285 Val Pro Leu Glu Leu Glu Asp Trp Leu Arg Leu Gly Arg Gly Thr Pro 290 295 300 Thr Ile Val Asp Leu Met Pro Ser Gly Arg Phe Leu Met Glu Glu Phe 305 310 315 320 Tyr Tyr Ala Gly Gly Leu Pro Ala Val Leu Arg Arg Leu Gly Glu Ala 325 330 335 Asn Leu Leu Pro His Pro Gly Ala Leu Thr Val Asn Gly Gln Ser Leu 340 345 350 Trp Asp Asn Val Arg Asp Ala Pro Ser His Asp Asp Glu Val Ile Arg 355 360 365 Pro Leu Asp Arg Pro Leu Ile Ala Asp Gly Gly Ile Arg Ile Leu Arg 370 375 380 Gly Asn Leu Ala Pro Arg Gly Ala Val Leu Lys Pro Ser Ala Ala Ser 385 390 395 400 Pro Glu Leu Leu Lys His Arg Gly Arg Ala Val Val Phe Glu Asn Phe 405 410 415 Glu His Tyr Lys Ala Thr Ile Asp Asp Glu Ala Leu Asp Val Asp Ala 420 425 430 Asn Ser Val Leu Val Leu Lys Asn Cys Gly Pro Arg Gly Tyr Pro Gly 435 440 445 Met Ala Glu Val Gly Asn Met Gly Leu Pro Pro Lys Leu Leu Arg Gln 450 455 460 Gly Val Lys Asp Met Val Arg Ile Ser Asp Ala Arg Met Ser Gly Thr 465 470 475 480 Ala Tyr Gly Thr Val Val Leu His Val Ala Pro Glu Ala Ala Ala Gly 485 490 495 Gly Pro Leu Ala Ala Val Arg Asn Gly Asp Trp Ile Glu Leu Asp Gly 500 505 510 Glu Ala Gly Thr Leu Thr Leu Asp Val Ser Asp Asp Glu Leu Ala Arg 515 520 525 Arg Leu Ser Asp His Asp Pro Ala Ser Ala Pro Gly Val Ala Glu His 530 535 540 Ala Ala Gly Gly Gly Tyr Ala Arg Leu Tyr Val Asp His Val Leu Gln 545 550 555 560 Ala Asp Glu Gly Cys Asp Leu Asp Phe Leu Val Gly Arg Arg Gly Ala 565 570 575 Ala Val Pro Arg His Ser His 580 57583PRTBurkholderia thailandensis 57Met Ser Ala Ser Lys Pro Lys Leu Arg Ser Ala Gln Trp Phe Gly Thr 1 5 10 15 His Asp Lys Asn Gly Phe Met Tyr Arg Ser Trp Met Lys Asn Gln Gly 20 25 30 Ile Pro Asp His Glu Phe Asp Gly Arg Pro Ile Val Gly Ile Cys Asn 35 40 45 Thr Trp Ser Glu Leu Thr Pro Cys Asn Ala His Phe Arg Lys Leu Ala 50 55 60 Glu His Val Lys Arg Gly Val Tyr Glu Ala Gly Gly Phe Pro Val Glu 65 70 75 80 Phe Pro Val Phe Ser Asn Gly Glu Ser Asn Leu Arg Pro Ser Ala Met 85 90 95 Leu Thr Arg Asn Leu Ala Ser Met Asp Val Glu Glu Ala Ile Arg Gly 100 105 110 Asn Pro Ile Asp Ala Val Val Leu Leu Ala Gly Cys Asp Lys Thr Thr 115 120 125 Pro Ala Leu Leu Met Gly Ala Ala Ser Cys Asp Val Pro Ala Ile Val 130 135 140 Val Ser Gly Gly Pro Met Leu Asn Gly Lys Leu Asp Gly Arg Asn Ile 145 150 155 160 Gly Ser Gly Thr Ala Val Trp Gln Leu His Glu Ala Leu Lys Ala Gly 165 170 175 Glu Ile Asp Leu His Arg Phe Leu Ser Ala Glu Ala Gly Met Ser Arg 180 185 190 Ser Ala Gly Thr Cys Asn Thr Met Gly Thr Ala Ser Thr Met Ala Cys 195 200 205 Leu Ala Glu Ala Leu Gly Val Ala Leu Pro His Asn Ala Ala Ile Pro 210 215 220 Ala Val Asp Ala Arg Arg Tyr Val Leu Ala His Met Ser Gly Met Arg 225 230 235 240 Ile Val Gly Met Ala His Glu Gly Leu Val Leu Ser Lys Ile Leu Thr 245 250 255 Arg Ala Ala Phe Glu Asn Ala Ile Arg Val Asn Ala Ala Ile Gly Gly 260 265 270 Ser Thr Asn Ala Val Ile His Leu Lys Ala Ile Ala Gly Arg Leu Gly 275 280 285 Val Pro Leu Glu Leu Glu Asp Trp Leu Arg Leu Gly Arg Gly Thr Pro 290 295 300 Thr Ile Val Asp Leu Met Pro Ser Gly Arg Phe Leu Met Glu Glu Phe 305 310 315 320 Tyr Tyr Ala Gly Gly Leu Pro Ala Val Leu Arg Arg Leu Gly Glu Ala 325 330 335 Asn Leu Leu Pro His Pro Gly Ala Leu Thr Val Asn Gly Gln Ser Leu 340 345 350 Trp Asp Asn Val Arg Asp Ala Pro Ser His Asp Asp Glu Val Ile Arg 355 360 365 Pro Leu Asp Arg Pro Leu Ile Ala Asp Gly Gly Ile Arg Ile Leu Arg 370 375 380 Gly Asn Leu Ala Pro Arg Gly Ala Val Leu Lys Pro Ser Ala Ala Ser 385 390 395 400 Pro Glu Leu Leu Lys His Arg Gly Arg Ala Val Val Phe Glu Asn Phe 405 410 415 Glu His Tyr Lys Ala Thr Ile Asp Asp Glu Ala Leu Glu Val Asp Ala 420 425 430 Asn Ser Val Leu Val Leu Lys Asn Cys Gly Pro Arg Gly Tyr Pro Gly 435 440 445 Met Ala Glu Val Gly Asn Met Gly Leu Pro Pro Lys Leu Leu Arg Gln 450 455 460 Gly Val Lys Asp Met Val Arg Ile Ser Asp Ala Arg Met Ser Gly Thr 465 470 475 480 Ala Tyr Gly Thr Val Val Leu His Val Ala Pro Glu Ala Ala Ala Gly 485 490 495 Gly Pro Leu Ala Ala Val Arg Asn Gly Asp Trp Ile Glu Leu Asp Cys 500 505 510 Glu Ala Gly Thr Leu Thr Leu Asp Val Ser Asp Asp Glu Leu Ala Arg 515 520 525 Arg Leu Ser Asp His Asp Pro Ala Ser Ala Pro Gly Val Ala Glu His 530 535 540 Ala Ala Gly Gly Gly Tyr Ala Arg Leu Tyr Val Asp His Val Leu Gln 545 550 555 560 Ala Asp Glu Gly Cys Asp Leu Asp Phe Leu Val Gly Arg Arg Gly Ala 565 570 575 Ala Val Pro Arg His Ser His 580 58583PRTBurkholderia multivorans 58Met Ser Ala Thr Lys Pro Arg Leu Arg Ser Ala Gln Trp Phe Gly Thr 1 5 10 15 Asn Asp Lys Asn Gly Phe Met Tyr Arg Ser Trp Met Lys Asn Gln Gly 20 25 30 Ile Pro Asp His Glu Phe Asp Gly Arg Pro Ile Ile Gly Ile Cys Asn 35 40 45 Thr Trp Ser Glu Leu Thr Pro Cys Asn Ala His Phe Arg Lys Leu Ala 50 55 60 Glu His Val Lys Arg Gly Ile Phe Glu Ala Gly Gly Phe Pro Val Glu 65 70 75 80 Phe Pro Val Phe Ser Asn Gly Glu Ser Asn Leu Arg Pro Ser Ala Met 85 90 95 Leu Thr Arg Asn Leu Ala Ser Met Asp Val Glu Glu Ala Ile Arg Gly 100 105 110 Asn Pro Ile Asp Ala Val Val Leu Leu Ala Gly Cys Asp Lys Thr Thr 115 120 125 Pro Ala Leu Leu Met Gly Ala Ala Ser Cys Asp Val Pro Ala Ile Val 130 135 140 Val Ser Gly Gly Pro Met Leu Asn Gly Lys Leu Glu Gly Lys Asn Ile 145 150 155 160 Gly Ser Gly Thr Ala Val Trp Gln Leu His Glu Ala Leu Lys Ala Gly 165 170 175 Glu Ile Asp Leu His His Phe Leu Ser Ala Glu Ala Gly Met Ser Arg 180 185 190 Ser Ala Gly Thr Cys Asn Thr Met Gly Thr Ala Ser Thr Met Ala Cys 195 200 205 Met Ala Glu Ala Leu Gly Val Ala Leu Pro His Asn Ala Ala Ile Pro 210 215 220 Ala Val Asp Ser Arg Arg Tyr Val Leu Ala His Met Ser Gly Ile Arg 225 230 235 240 Ile Val Glu Met Ala Leu Glu Gly Leu Val Leu Ser Lys Val Leu Thr 245 250 255 Arg Ala Ala Phe Glu Asn Ala Ile Arg Val Asn Ala Ala Ile Gly Gly 260 265 270 Ser Thr Asn Ala Val Ile His Leu Lys Ala Ile Ala Gly Arg Ile Gly 275 280 285 Val Pro Leu Glu Leu Glu Asp Trp Met Arg Ile Gly Arg Asp Thr Pro 290 295 300 Thr Ile Val Asp Leu Met Pro Ser Gly Arg Phe Leu Met Glu Glu Phe 305 310 315 320 Tyr Tyr Ala Gly Gly Leu Pro Ala Val Leu Arg Arg Leu Gly Glu Gly 325 330 335 Gly Leu Leu Pro His Pro Asp Ala Leu Thr Val Asn Gly Lys Thr Leu 340 345 350 Trp Asp Asn Val Arg Glu Ala Pro Asn Tyr Asp Asp Glu Val Ile Arg 355 360 365 Pro Leu Asp Arg Pro Leu Ile Ala Asp Gly Gly Ile Arg Ile Leu Arg 370 375 380 Gly Asn Leu Ala Pro Arg Gly Ala Val Leu Lys Pro Ser Ala Ala Ser 385 390 395 400 Pro Glu Leu Leu Lys His Arg Gly Arg Ala Val Val Phe Glu Asn Phe 405 410 415 Asp His Tyr Lys Ala Thr Ile Asn Asp Glu Ser Leu Asp Val Asp Ala 420 425 430 Asn Ser Val Leu Val Leu Lys Asn Cys Gly Pro Arg Gly Tyr Pro Gly 435 440 445 Met Ala Glu Val Gly Asn Met Gly Leu Pro Pro Lys Leu Leu Arg Gln 450 455 460 Gly Val Lys Asp Met Val Arg Ile Ser Asp Ala Arg Met Ser Gly Thr 465 470 475 480 Ala Tyr Gly Thr Val Val Leu His Val Ala Pro Glu Ala Ala Ala Gly 485 490 495 Gly Pro Leu Ala Ala Val Arg Asn Gly Asp Trp Ile Glu Leu Asp Cys 500 505 510 Glu Ala Gly Thr Leu His Leu Asp Ile Pro Asp Asp Glu Leu Gln Arg 515 520 525 Arg Leu Ser Asp Val Asp Pro Ala Ala Ala Pro Gly Val Ala Gly Gln 530 535 540 Ala Gly Lys Gly Gly Tyr Ala Arg Leu Tyr Leu Asp His Val Leu Gln 545 550 555 560 Ala Asp Glu Gly Cys Asp Leu Asp Phe Leu Val Gly Thr Arg Gly Ala 565 570 575 Glu Val Pro Ser His Ser His 580 59583PRTBurkholderia multivorans 59Met Ser Ala Thr Lys Pro Arg Leu Arg Ser Ala Gln Trp Phe Gly Thr 1 5 10 15 Asn Asp Lys Asn Gly Phe Met Tyr Arg Ser Trp Met Lys Asn Gln Gly 20 25 30 Ile Pro Asp His Glu Phe Asp Gly Arg Pro Ile Ile Gly Ile Cys Asn 35 40 45 Thr Trp Ser Glu Leu Thr Pro Cys Asn Ala His Phe Arg Lys Leu Ala 50 55 60 Glu His Val Lys Arg Gly Ile Phe Glu Ala Gly Gly Phe Pro Val Glu 65 70 75 80 Phe Pro Val Phe Ser Asn Gly Glu Ser Asn Leu Arg Pro Ser Ala Met 85 90 95 Leu Thr Arg Asn Leu Ala Ser Met Asp Val Glu Glu Ala Ile Arg Gly 100 105 110 Asn Pro Ile Asp Ala Val Val Leu Leu Ala Gly Cys Asp Lys Thr Thr 115 120 125 Pro Ala Leu Leu Met Gly Ala Ala Ser Cys Asp Val Pro Ala Ile Val 130 135 140 Val Ser Gly Gly Pro Met Leu Asn Gly Lys Leu Glu Gly Lys Asn Ile 145 150 155 160 Gly Ser Gly Thr Ala Val Trp Gln Leu His Glu Ala Leu Lys Ala Gly 165 170 175 Glu Ile Asp Leu His His Phe Leu Ser Ala Glu Ala Gly Met Ser Arg 180 185 190 Ser Ala Gly Thr Cys Asn Thr Met Gly Thr Ala Ser Thr Met Ala Cys 195 200 205 Met Ala Glu Ala Leu Gly Val Ala Leu Pro His Asn Ala Ala Ile Pro 210 215 220 Ala Val Asp Ser Arg Arg Tyr Val Leu Ala His Met Ser Gly Ile Arg 225 230 235 240 Ile Val Glu Met Ala Leu Glu Gly Leu Val Leu Ser Lys Val Leu Thr 245 250 255 Arg Ala Ala Phe Glu Asn Ala Ile Arg Val Asn Ala Ala Ile Gly Gly 260 265 270 Ser Thr Asn Ala Val Ile His Leu Lys Ala Ile Ala Gly Arg Ile Gly 275 280 285 Val Pro Leu Glu Leu Glu Asp Trp Met Arg Ile Gly Arg Asp Thr Pro 290 295 300 Thr Ile Val Asp Leu Met Pro Ser Gly Arg Phe Leu Met Glu Glu Phe 305 310 315 320 Tyr Tyr Ala Gly Gly Leu Pro Ala Val Leu Arg Arg Leu Gly Glu Gly 325 330 335 Gly Leu Leu Pro His Pro Asp Ala Leu Thr Val Asn Gly Lys Thr Leu 340 345 350 Trp Asp Asn Val Arg Asp Ala Pro Asn Tyr Asp Asp Glu Val Ile Arg 355

360 365 Pro Leu Asp Arg Pro Leu Ile Ala Asp Gly Gly Ile Arg Ile Leu Arg 370 375 380 Gly Asn Leu Ala Pro Arg Gly Ala Val Leu Lys Pro Ser Ala Ala Ser 385 390 395 400 Pro Glu Leu Leu Lys His Arg Gly Arg Ala Val Val Phe Glu Asn Phe 405 410 415 Asp His Tyr Lys Ala Thr Ile Asn Asp Glu Ala Leu Asp Val Asp Ala 420 425 430 Asn Ser Val Leu Val Leu Lys Asn Cys Gly Pro Arg Gly Tyr Pro Gly 435 440 445 Met Ala Glu Val Gly Asn Met Gly Leu Pro Pro Lys Leu Leu Arg Gln 450 455 460 Gly Val Lys Asp Met Val Arg Ile Ser Asp Ala Arg Met Ser Gly Thr 465 470 475 480 Ala Tyr Gly Thr Val Val Leu His Val Ala Pro Glu Ala Ala Ala Gly 485 490 495 Gly Pro Leu Ala Ala Val Arg Asn Gly Asp Trp Ile Glu Leu Asp Cys 500 505 510 Glu Ala Gly Thr Leu His Leu Asp Ile Pro Asp Asp Glu Leu Gln Arg 515 520 525 Arg Leu Ser Asp Val Asp Pro Ala Ala Ala Pro Gly Val Ala Gly Gln 530 535 540 Ala Gly Lys Gly Gly Tyr Ala Arg Leu Tyr Leu Asp His Val Leu Gln 545 550 555 560 Ala Asp Glu Gly Cys Asp Leu Asp Phe Leu Val Gly Thr Arg Gly Ala 565 570 575 Glu Val Pro Ser His Ser His 580 60583PRTBurkholderia thailandensis 60Met Ser Ala Ser Lys Pro Lys Leu Arg Ser Ala Gln Trp Phe Gly Thr 1 5 10 15 His Asp Lys Asn Gly Phe Met Tyr Arg Ser Trp Met Lys Asn Gln Gly 20 25 30 Ile Pro Asp His Glu Phe Asp Gly Arg Pro Ile Val Gly Ile Cys Asn 35 40 45 Thr Trp Ser Glu Leu Thr Pro Cys Asn Ala His Phe Arg Lys Leu Ala 50 55 60 Glu His Val Lys Arg Gly Val Tyr Glu Ala Gly Gly Phe Pro Val Glu 65 70 75 80 Phe Pro Val Phe Ser Asn Gly Glu Ser Asn Leu Arg Pro Ser Ala Met 85 90 95 Leu Thr Arg Asn Leu Ala Ser Met Asp Val Glu Glu Ala Ile Arg Gly 100 105 110 Asn Pro Ile Asp Ala Val Val Leu Leu Ala Gly Cys Asp Lys Thr Thr 115 120 125 Pro Ala Leu Leu Met Gly Ala Ala Ser Cys Asp Val Pro Ala Ile Val 130 135 140 Val Ser Gly Gly Pro Met Leu Asn Gly Lys Leu Asp Gly Lys Asn Ile 145 150 155 160 Gly Ser Gly Thr Ala Val Trp Gln Leu His Glu Ala Leu Lys Ala Gly 165 170 175 Glu Ile Asp Leu His Arg Phe Leu Ser Ala Glu Ala Gly Met Ser Arg 180 185 190 Ser Ala Gly Thr Cys Asn Thr Met Gly Thr Ala Ser Thr Met Ala Cys 195 200 205 Leu Ala Glu Ala Leu Gly Val Ala Leu Pro His Asn Ala Ala Ile Pro 210 215 220 Ala Val Asp Ala Arg Arg Tyr Val Leu Ala His Leu Ser Gly Ala Arg 225 230 235 240 Ile Val Glu Met Ala His Glu Gly Leu Ala Leu Ser Thr Ile Leu Thr 245 250 255 Arg Ala Ala Phe Glu Asn Ala Ile Arg Ala Asn Ala Ala Ile Gly Gly 260 265 270 Ser Thr Asn Ala Val Ile His Leu Lys Ala Ile Ala Gly Arg Leu Gly 275 280 285 Val Pro Leu Glu Leu Glu Asp Trp Met Arg Ile Gly Arg Asp Thr Pro 290 295 300 Thr Ile Val Asp Leu Met Pro Ser Gly Arg Phe Leu Met Glu Glu Phe 305 310 315 320 Tyr Tyr Ala Gly Gly Leu Pro Ala Val Leu Arg Arg Leu Gly Glu Ala 325 330 335 Asn Leu Leu Pro His Pro Gly Ala Leu Thr Val Asn Gly Lys Ser Leu 340 345 350 Trp Glu Asn Val Arg Asp Ala Pro Asn His Asp Asp Glu Val Ile Arg 355 360 365 Pro Leu Ala Arg Pro Leu Ile Ala Asp Gly Gly Ile Arg Val Leu Arg 370 375 380 Gly Asn Leu Ala Pro Arg Gly Ala Val Leu Lys Pro Ser Ala Ala Ser 385 390 395 400 Pro Glu Leu Leu Arg His Arg Gly Arg Ala Val Val Phe Glu Asn Phe 405 410 415 Glu His Tyr Lys Ala Thr Ile Asp Asp Glu Ala Leu Asp Val Asp Ala 420 425 430 Ser Ser Val Leu Val Leu Lys Asn Cys Gly Pro Arg Gly Tyr Pro Gly 435 440 445 Met Ala Glu Val Gly Asn Met Gly Leu Pro Pro Lys Leu Leu Arg Gln 450 455 460 Gly Val Lys Asp Met Val Arg Ile Ser Asp Ala Arg Met Ser Gly Thr 465 470 475 480 Ala Tyr Gly Thr Val Val Leu His Val Ala Pro Glu Ala Ala Ala Gly 485 490 495 Gly Pro Leu Ala Ala Val Arg Asn Gly Asp Trp Ile Ala Leu Asp Cys 500 505 510 Glu Ala Gly Thr Leu Thr Leu Asp Val Ser Asp Asp Glu Leu Ala Arg 515 520 525 Arg Leu Ser Asp Leu Asp Pro Ala Ser Ala Pro Gly Ala Ala Gly Gln 530 535 540 Ala Gly Ser Gly Gly Tyr Ala Arg Leu Tyr Val Asp His Val Leu Gln 545 550 555 560 Ala Asp Glu Gly Cys Asp Leu Asp Phe Leu Val Gly Arg Arg Gly Ala 565 570 575 Ala Val Pro Arg His Ser His 580 61309PRTBurkholderia thailandensis 61Met Asn Thr Ser Arg Ser Pro Arg Tyr Arg Gly Val Phe Pro Val Val 1 5 10 15 Pro Thr Thr Phe Ala Glu Ala Gly Glu Leu Asp Leu Pro Ser Gln Lys 20 25 30 Arg Ala Val Asp Phe Met Ile Asp Ala Gly Ser Glu Gly Leu Cys Ile 35 40 45 Leu Ala Asn Phe Ser Glu Gln Phe Ala Leu Ala Asp Asp Glu Arg Asp 50 55 60 Val Leu Thr Arg Thr Ile Leu Glu His Val Ala Gly Arg Val Pro Val 65 70 75 80 Ile Val Thr Thr Thr His Tyr Ser Thr Gln Val Cys Ala Ala Arg Ser 85 90 95 Arg Arg Ala Gln Glu Leu Gly Ala Ala Met Val Met Ala Met Pro Pro 100 105 110 Tyr His Gly Ala Thr Phe Arg Val Pro Asp Thr Gln Ile His Ala Phe 115 120 125 Tyr Ala Arg Leu Ser Asp Ala Leu Asp Ile Pro Ile Met Ile Gln Asp 130 135 140 Ala Pro Ala Ser Gly Thr Val Leu Ser Ala Pro Phe Leu Ala Arg Met 145 150 155 160 Ala Arg Glu Ile Glu Gln Val Ser Tyr Phe Lys Ile Glu Thr Pro Gly 165 170 175 Ala Ala Asn Lys Leu Arg Glu Leu Ile Arg Leu Gly Gly Asp Ala Ile 180 185 190 Glu Gly Pro Trp Asp Gly Glu Glu Ala Ile Thr Leu Leu Ala Asp Leu 195 200 205 Asn Ala Gly Ala Thr Gly Ala Met Thr Gly Gly Ala Tyr Pro Asp Gly 210 215 220 Ile Arg Pro Ile Val Glu Ala His Arg Glu Gly Arg Ala Asp Asp Ala 225 230 235 240 Phe Ala Leu Tyr Gln Arg Trp Leu Pro Leu Ile Asn His Glu Asn Arg 245 250 255 Gln Thr Gly Leu Leu Ala Ala Lys Ala Leu Met Arg Glu Gly Gly Val 260 265 270 Ile Ala Cys Glu Arg Pro Arg His Pro Leu Pro Pro Ile His Pro Asp 275 280 285 Ser Arg Ala Glu Leu Ile Ala Ile Ala Arg Arg Leu Asp Pro Leu Val 290 295 300 Leu Arg Trp Ala Arg 305 62309PRTBurkholderia thailandensis 62Met Asn Thr Ser Arg Ser Pro Arg Tyr Arg Gly Val Phe Pro Val Val 1 5 10 15 Pro Thr Thr Phe Thr Glu Ala Gly Glu Leu Asp Leu Pro Ser Gln Lys 20 25 30 Arg Ala Val Asp Phe Met Ile Asp Ala Gly Ser Glu Gly Leu Cys Ile 35 40 45 Leu Ala Asn Phe Ser Glu Gln Phe Ala Leu Ala Asp Asp Glu Arg Asp 50 55 60 Val Leu Thr Arg Thr Ile Leu Glu His Val Ala Gly Arg Val Pro Val 65 70 75 80 Ile Val Thr Thr Thr His Tyr Ser Thr Gln Val Cys Ala Ala Arg Ser 85 90 95 Arg Arg Ala Gln Glu Leu Gly Ala Ala Met Val Met Ala Met Pro Pro 100 105 110 Tyr His Gly Ala Thr Phe Arg Val Pro Asp Thr Gln Ile His Ala Phe 115 120 125 Tyr Ala Arg Leu Ser Asp Ala Leu Asp Ile Pro Ile Met Ile Gln Asp 130 135 140 Ala Pro Ala Ser Gly Thr Val Leu Ser Ala Pro Phe Leu Ala Arg Met 145 150 155 160 Ala Arg Glu Ile Glu Gln Val Ser Tyr Phe Lys Ile Glu Thr Pro Gly 165 170 175 Ala Ala Asn Lys Leu Arg Glu Leu Ile Arg Leu Gly Gly Asp Ala Ile 180 185 190 Glu Gly Pro Trp Asp Gly Glu Glu Ala Ile Thr Leu Leu Ala Asp Leu 195 200 205 Asn Ala Gly Ala Thr Gly Ala Met Thr Gly Gly Ala Tyr Pro Asp Gly 210 215 220 Ile Arg Pro Ile Val Glu Ala His Arg Glu Gly Arg Ala Asp Asp Ala 225 230 235 240 Phe Ala Leu Tyr Gln Arg Trp Leu Pro Leu Ile Asn His Glu Asn Arg 245 250 255 Gln Thr Gly Leu Leu Ala Ala Lys Ala Leu Met Arg Glu Gly Gly Val 260 265 270 Ile Ala Cys Glu Arg Pro Arg His Pro Leu Pro Pro Ile His Pro Asp 275 280 285 Ser Arg Ala Glu Leu Ile Ala Ile Ala Arg Arg Leu Asp Pro Leu Val 290 295 300 Leu Arg Trp Ala Arg 305 63309PRTBurkholderia thailandensis 63Met Asn Thr Ser Arg Ser Pro Arg Tyr Arg Gly Val Phe Pro Val Val 1 5 10 15 Pro Thr Thr Phe Thr Glu Thr Gly Glu Leu Asp Leu Pro Ser Gln Met 20 25 30 Arg Ala Val Asp Phe Met Ile Asp Ala Gly Ser Glu Gly Leu Cys Ile 35 40 45 Leu Ala Asn Phe Ser Glu Gln Phe Ala Leu Ala Asp Asp Glu Arg Asp 50 55 60 Val Leu Thr Arg Thr Ile Leu Glu His Val Ala Gly Arg Val Pro Val 65 70 75 80 Ile Val Thr Thr Thr His Tyr Ser Thr Arg Val Cys Ala Ala Arg Ser 85 90 95 Arg Arg Ala Gln Glu Leu Gly Ala Ala Met Val Met Ala Met Pro Pro 100 105 110 Tyr His Gly Ala Thr Phe Arg Val Pro Asp Thr Gln Ile His Ala Phe 115 120 125 Tyr Ala Arg Leu Ser Asp Ala Leu Asp Ile Pro Ile Met Ile Gln Asp 130 135 140 Ala Pro Ala Ser Gly Thr Val Leu Ser Ala Pro Phe Leu Ala Arg Met 145 150 155 160 Ala Arg Glu Ile Glu Gln Val Ser Tyr Phe Lys Ile Glu Thr Pro Gly 165 170 175 Ala Ala Asn Lys Leu Arg Glu Leu Ile Arg Leu Gly Gly Asp Ala Ile 180 185 190 Glu Gly Pro Trp Asp Gly Glu Glu Ala Ile Thr Leu Leu Ala Asp Leu 195 200 205 Asn Ala Gly Ala Thr Gly Ala Met Thr Gly Gly Ala Tyr Pro Asp Gly 210 215 220 Ile Arg Pro Ile Val Asp Ala His Arg Asp Gly Arg Ala Asp Asp Ala 225 230 235 240 Phe Ala Leu Tyr Gln Arg Trp Leu Pro Leu Ile Asn His Glu Asn Arg 245 250 255 Gln Thr Gly Leu Val Ala Ala Lys Ala Leu Met Arg Glu Gly Gly Val 260 265 270 Ile Ala Cys Glu Arg Pro Arg His Pro Leu Pro Pro Ile His Pro Asp 275 280 285 Ser Arg Ala Glu Leu Ile Glu Ile Ala Arg Arg Leu Asp Pro Leu Val 290 295 300 Leu Arg Trp Ala Arg 305 64309PRTBurkholderia dolosa 64Met Thr Ser Ser Arg Thr Pro Arg Tyr Arg Gly Ile Phe Pro Val Val 1 5 10 15 Pro Thr Thr Phe Thr Asp Thr Gly Glu Leu Asp Leu Ala Ser Gln Lys 20 25 30 Arg Ala Val Asp Phe Met Ile Asp Ala Gly Ser Asp Gly Leu Cys Ile 35 40 45 Leu Ala Asn Phe Ser Glu Gln Phe Ala Ile Thr Asp Asp Glu Arg Asp 50 55 60 Val Leu Thr Arg Thr Ile Leu Glu His Val Ala Gly Arg Val Pro Val 65 70 75 80 Ile Val Thr Thr Thr His Tyr Ser Thr Gln Val Cys Ala Ala Arg Ser 85 90 95 Leu Arg Ala Gln Gln Leu Gly Ala Ala Met Val Met Ala Met Pro Pro 100 105 110 Tyr His Gly Ala Thr Phe Arg Val Pro Glu Ala Gln Ile Tyr Asp Phe 115 120 125 Tyr Ala Arg Val Ser Asp Ala Ile Asp Ile Pro Ile Met Ile Gln Asp 130 135 140 Ala Pro Ala Ser Gly Thr Val Leu Ser Ala Pro Leu Leu Ala Arg Met 145 150 155 160 Ala Arg Glu Ile Glu Gln Val Ser Tyr Phe Lys Ile Glu Thr Pro Gly 165 170 175 Ala Ala Asn Lys Leu Arg Glu Leu Ile Arg Leu Gly Gly Asp Ala Val 180 185 190 Glu Gly Pro Trp Asp Gly Glu Glu Ala Ile Thr Leu Leu Ala Asp Leu 195 200 205 Asn Ala Gly Ala Thr Gly Ala Met Thr Gly Gly Ala Tyr Pro Asp Gly 210 215 220 Ile Arg Pro Ile Leu Glu Ala His Arg Glu Gly Arg His Asp Asp Ala 225 230 235 240 Phe Ala His Tyr Gln Arg Trp Leu Pro Leu Ile Asn His Glu Asn Arg 245 250 255 Gln Ser Gly Ile Leu Ser Ala Lys Ala Leu Met Arg Glu Gly Gly Val 260 265 270 Ile Ala Cys Glu Arg Pro Arg His Pro Met Pro Glu Leu His Pro Asp 275 280 285 Thr Arg Ala Glu Leu Ile Ala Ile Ala Arg Arg Leu Asp Pro Leu Val 290 295 300 Leu Arg Trp Ala Arg 305 65309PRTBurkholderia multivorans 65Met Thr Ser Ser Arg Thr Pro Arg Tyr Arg Gly Ile Phe Pro Val Val 1 5 10 15 Pro Thr Thr Phe Thr Glu Thr Gly Glu Leu Asp Leu Ala Ser Gln Lys 20 25 30 Arg Ala Val Asp Phe Met Ile Asp Ala Gly Ser Asp Gly Leu Cys Ile 35 40 45 Leu Ala Asn Phe Ser Glu Gln Phe Ala Leu Ala Asp Asp Glu Arg Asp 50 55 60 Val Leu Thr Arg Thr Ile Leu Glu His Val Ala Gly Arg Val Pro Val 65 70 75 80 Ile Val Thr Thr Ser His Tyr Ser Thr Gln Thr Cys Ile Ala Arg Ser 85 90 95 Val Arg Ala Gln Gln Leu Gly Ala Ala Met Val Met Val Met Pro Pro 100 105 110 Tyr His Gly Ala Thr Phe Arg Val Pro Glu Ala Gln Ile His Ala Phe 115 120 125 Tyr Ala Arg Leu Ser Asp Ala Leu Ser Ile Pro Ile Met Ile Gln Asp 130 135 140 Ala Pro Ala Ser Gly Thr Val Leu Ser Ala Pro Phe Leu Ala Gln Leu 145 150 155 160 Ala Arg Glu Ile Glu His Val Ala Tyr Phe Lys Ile Glu Thr Pro Gly 165 170 175 Ala Ala Asn Lys Leu Arg Glu Leu Ile Arg Leu Gly Gly Asp Ala Ile 180 185 190 Glu Gly Pro Trp Asp Gly Glu Glu Ala Ile Thr Leu Leu Ala Asp Leu 195 200 205 His Ala Gly Ala Thr Gly Ala Met Thr Gly Gly Ala Tyr Pro Asp Gly 210 215 220 Ile Arg Pro Ile Leu Glu Ala His Arg Glu Gly Arg His Asp Asp Ala 225 230 235 240 Phe Ala Arg

Tyr Gln Thr Trp Leu Pro Leu Ile Asn His Glu Asn Arg 245 250 255 Gln Ser Gly Ile Leu Thr Ala Lys Ala Leu Met Arg Glu Gly Gly Val 260 265 270 Ile Ala Cys Glu Ala Pro Arg His Pro Met Pro Ala Leu His Pro Asp 275 280 285 Thr Arg Ala Glu Leu Ile Ala Ile Ala Arg Arg Leu Asp Pro Leu Val 290 295 300 Leu Arg Trp Ala Arg 305 66455PRTBacillus subtilis 66Met Ser Ser Pro Ile Gln Glu Gln Val Gln Lys Glu Lys Arg Ser Asn 1 5 10 15 Ile Pro Ser Ile Ser Glu Met Lys Val Ile Pro Val Ala Gly His Asp 20 25 30 Ser Met Leu Leu Asn Leu Ser Gly Ala His Ser Pro Phe Phe Thr Arg 35 40 45 Asn Ile Val Ile Leu Thr Asp Ser Ser Gly Asn Gln Gly Val Gly Glu 50 55 60 Val Pro Gly Gly Glu His Ile Arg Arg Thr Leu Glu Leu Ser Glu Pro 65 70 75 80 Leu Val Val Gly Lys Ser Ile Gly Ala Tyr Gln Ala Ile Leu Gln Thr 85 90 95 Val Arg Lys Gln Phe Gly Asp Gln Asp Arg Gly Gly Arg Gly Asn Gln 100 105 110 Thr Phe Asp Leu Arg Thr Thr Val His Ala Val Thr Ala Leu Glu Ala 115 120 125 Ala Leu Leu Asp Leu Leu Gly Lys Phe Leu Gln Glu Pro Val Ala Ala 130 135 140 Leu Leu Gly Glu Gly Lys Gln Arg Asp Glu Val Lys Met Leu Gly Tyr 145 150 155 160 Leu Phe Tyr Ile Gly Asp Arg Asn Arg Thr Thr Leu Pro Tyr Gln Ser 165 170 175 Asp Glu Gln Ser Asp Cys Ala Trp Phe Arg Leu Arg His Glu Glu Ala 180 185 190 Leu Thr Pro Glu Ala Ile Val Arg Leu Ala Glu Ser Ala Gln Glu Arg 195 200 205 Tyr Gly Phe Gln Asp Phe Lys Leu Lys Gly Gly Val Leu Arg Gly Glu 210 215 220 Glu Glu Ile Glu Ala Val Thr Ala Leu Ser Lys Arg Phe Pro Glu Ala 225 230 235 240 Arg Ile Thr Leu Asp Pro Asn Gly Ala Trp Ser Leu Glu Glu Ala Ile 245 250 255 Ala Leu Cys Lys Gly Lys Gln Asp Val Leu Ala Tyr Ala Glu Asp Pro 260 265 270 Cys Gly Asp Glu Asn Gly Tyr Ser Ala Arg Glu Val Met Ala Glu Phe 275 280 285 Arg Arg Ala Thr Gly Leu Pro Thr Ala Thr Asn Met Ile Ala Thr Asp 290 295 300 Trp Arg Glu Met Gly His Ala Ile Gln Leu His Ala Val Asp Ile Pro 305 310 315 320 Leu Ala Asp Pro His Phe Trp Thr Met Gln Gly Ser Val Arg Val Ala 325 330 335 Gln Met Cys His Asp Trp Gly Leu Thr Trp Gly Ser His Ser Asn Asn 340 345 350 His Phe Asp Ile Ser Leu Ala Met Phe Thr His Val Ala Ala Ala Ala 355 360 365 Pro Gly Arg Ile Thr Ala Ile Asp Thr His Trp Ile Trp Gln Asp Gly 370 375 380 Gln Arg Leu Thr Lys Gln Pro Phe Glu Ile Ser Ser Gly Cys Val Lys 385 390 395 400 Val Pro Asp Lys Pro Gly Leu Gly Val Asp Ile Asp Met Glu Gln Val 405 410 415 Glu Lys Ala His Glu Ile Tyr Arg Lys Met Asn Leu Gly Ala Arg Asn 420 425 430 Asp Ala Ile Pro Met Gln Phe Leu Ile Ser Asn Trp Glu Phe Asp Arg 435 440 445 Lys Arg Pro Cys Leu Val Arg 450 455 67455PRTBacillus subtilis 67Met Ser Ser Pro Ile Gln Glu Gln Val Gln Lys Glu Lys Arg Ser Asn 1 5 10 15 Ile Pro Ser Ile Ser Glu Met Lys Val Ile Pro Val Ala Gly His Asp 20 25 30 Ser Met Leu Leu Asn Leu Ser Gly Ala His Ser Pro Phe Phe Thr Arg 35 40 45 Asn Ile Val Ile Leu Thr Asp Ser Ser Gly Asn Gln Gly Val Gly Glu 50 55 60 Val Pro Gly Gly Glu His Ile Arg Arg Thr Leu Glu Leu Ser Glu Pro 65 70 75 80 Leu Val Val Gly Lys Ser Ile Gly Ala Tyr Gln Ala Ile Leu Gln Thr 85 90 95 Val Arg Lys Gln Phe Gly Asp Gln Asp Arg Gly Gly Arg Gly Asn Gln 100 105 110 Thr Phe Asp Leu Arg Thr Thr Val His Ala Val Thr Ala Leu Glu Ala 115 120 125 Ala Leu Leu Asp Phe Leu Gly Lys Phe Leu Gln Glu Pro Val Ala Ala 130 135 140 Leu Leu Gly Glu Gly Lys Gln Arg Asp Glu Val Lys Met Leu Gly Tyr 145 150 155 160 Leu Phe Tyr Ile Gly Asp Arg Asn Arg Thr Thr Leu Pro Tyr Gln Ser 165 170 175 Asp Glu Gln Ser Asp Cys Ala Trp Phe Arg Leu Arg His Glu Glu Ala 180 185 190 Leu Thr Pro Glu Ala Ile Val Arg Leu Ala Glu Ser Ala Gln Glu Arg 195 200 205 Tyr Gly Phe Gln Asp Phe Lys Leu Lys Gly Gly Val Leu Arg Gly Glu 210 215 220 Glu Glu Ile Glu Ala Val Thr Ala Leu Ser Lys Arg Phe Pro Glu Ala 225 230 235 240 Arg Ile Thr Leu Asp Pro Asn Gly Ala Trp Ser Leu Glu Glu Ala Ile 245 250 255 Ala Leu Cys Lys Gly Lys Gln Asp Val Leu Ala Tyr Ala Glu Asp Pro 260 265 270 Cys Gly Asp Glu Asn Gly Tyr Ser Ala Arg Glu Val Met Ala Glu Phe 275 280 285 Arg Arg Ala Thr Gly Leu Pro Thr Ala Thr Asn Met Ile Ala Thr Asp 290 295 300 Trp Arg Glu Met Gly His Ala Ile Gln Leu His Ala Val Asp Ile Pro 305 310 315 320 Leu Ala Asp Pro His Phe Trp Thr Met Gln Gly Ser Val Arg Val Ala 325 330 335 Gln Met Cys His Asp Trp Gly Leu Thr Trp Gly Ser His Ser Asn Asn 340 345 350 His Phe Asp Ile Ser Leu Ala Met Phe Thr His Val Ala Ala Ala Ala 355 360 365 Pro Gly Arg Ile Thr Ala Ile Asp Thr His Trp Ile Trp Gln Asp Gly 370 375 380 Gln Arg Leu Thr Lys Gln Pro Phe Glu Ile Ser Ser Gly Cys Val Lys 385 390 395 400 Val Pro Asp Lys Pro Gly Leu Gly Val Asp Ile Asp Met Glu Gln Val 405 410 415 Glu Lys Ala His Glu Ile Tyr Arg Lys Met Asn Leu Gly Ala Arg Asn 420 425 430 Asp Ala Ile Pro Met Gln Phe Leu Ile Ser Asn Trp Glu Phe Asp Arg 435 440 445 Lys Arg Pro Cys Leu Val Arg 450 455 68455PRTBacillus subtilis 68Met Ser Ser Pro Ile Gln Glu Gln Val Gln Lys Glu Lys Arg Ser Asn 1 5 10 15 Ile Pro Ser Ile Thr Glu Met Lys Val Ile Pro Val Ala Gly His Asp 20 25 30 Ser Met Leu Leu Asn Leu Ser Gly Ala His Ser Pro Phe Phe Thr Arg 35 40 45 Asn Ile Val Ile Leu Thr Asp Ser Ser Gly Asn Gln Gly Val Gly Glu 50 55 60 Val Pro Gly Gly Glu His Ile Arg Arg Thr Leu Glu Leu Ser Glu Pro 65 70 75 80 Leu Val Val Gly Lys Ser Ile Gly Ala Tyr Gln Ala Ile Leu Gln Thr 85 90 95 Val Arg Lys Gln Phe Gly Asp Gln Asp Arg Gly Gly Arg Gly Asn Gln 100 105 110 Thr Phe Asp Leu Arg Thr Thr Val His Ala Val Thr Ala Leu Glu Ala 115 120 125 Ala Leu Leu Asp Leu Leu Gly Lys Phe Leu Gln Glu Pro Val Ala Ala 130 135 140 Leu Leu Gly Glu Gly Lys Gln Arg Asp Glu Val Lys Met Leu Gly Tyr 145 150 155 160 Leu Phe Tyr Ile Gly Asp Arg Lys Arg Thr Thr Leu Pro Tyr Gln Ser 165 170 175 Asp Glu Gln Ser Asp Cys Ala Trp Phe Arg Leu Arg His Glu Glu Ala 180 185 190 Leu Thr Pro Glu Ala Ile Val Arg Leu Ala Glu Ser Ala Gln Glu Arg 195 200 205 Tyr Gly Phe Gln Asp Phe Lys Leu Lys Gly Gly Val Leu Gln Gly Glu 210 215 220 Glu Glu Ile Glu Ala Val Thr Ala Leu Ser Lys Arg Phe Pro Glu Ala 225 230 235 240 Arg Ile Thr Leu Asp Pro Asn Gly Ala Trp Ser Leu Glu Glu Ala Ile 245 250 255 Ala Leu Cys Lys Gly Lys Gln Asp Val Leu Ala Tyr Ala Glu Asp Pro 260 265 270 Cys Gly Asp Glu Asn Gly Tyr Ser Ala Arg Glu Val Met Ala Glu Phe 275 280 285 Arg Arg Ala Thr Gly Leu Pro Thr Ala Thr Asn Met Ile Ala Thr Asp 290 295 300 Trp Arg Glu Met Gly His Ala Ile Gln Leu His Ala Val Asp Ile Pro 305 310 315 320 Leu Ala Asp Pro His Phe Trp Thr Met Gln Gly Ser Val Arg Val Ala 325 330 335 Gln Met Cys His Asp Trp Gly Leu Thr Trp Gly Ser His Ser Asn Asn 340 345 350 His Phe Asp Ile Ser Leu Ala Met Phe Thr His Val Ala Ala Ala Ala 355 360 365 Pro Gly Arg Ile Thr Ala Ile Asp Thr His Trp Ile Trp Gln Asp Gly 370 375 380 Gln Arg Leu Thr Lys Gln Pro Phe Glu Ile Ser Ser Gly Cys Val Lys 385 390 395 400 Val Pro Asp Lys Pro Gly Leu Gly Ile Asp Ile Asp Met Glu Gln Val 405 410 415 Glu Lys Ala His Glu Ile Tyr Arg Lys Met Asn Leu Gly Ala Arg Asn 420 425 430 Asp Ala Ile Pro Met Gln Phe Leu Ile Ser Asn Trp Glu Phe Asp Arg 435 440 445 Lys Arg Pro Cys Leu Val Arg 450 455 69455PRTBacillus subtilis 69Met Ser Ser Pro Ile Gln Glu Gln Val Gln Lys Glu Lys Arg Ser Asn 1 5 10 15 Ile Pro Ser Ile Cys Glu Met Lys Val Ile Pro Val Ala Gly His Asp 20 25 30 Ser Met Leu Leu Asn Leu Ser Gly Ala His Ser Pro Phe Phe Thr Arg 35 40 45 Asn Ile Val Ile Leu Thr Asp Ser Ser Gly Asn Gln Gly Val Gly Glu 50 55 60 Val Pro Gly Gly Glu Gln Ile Arg Arg Thr Leu Glu Leu Ala Glu Pro 65 70 75 80 Leu Val Val Gly Lys Ser Ile Gly Ala Tyr Gln Ser Ile Leu Gln Thr 85 90 95 Val Arg Lys Gln Phe Ala Asp Gln Asp Arg Gly Gly Arg Gly Ile Gln 100 105 110 Thr Phe Asp Leu Arg Thr Thr Val His Ala Val Thr Ala Leu Glu Ala 115 120 125 Ala Leu Leu Asp Leu Leu Gly Lys Phe Leu Gln Glu Pro Val Ala Ala 130 135 140 Leu Leu Gly Glu Gly Lys Gln Arg Asp Glu Val Lys Met Leu Gly Tyr 145 150 155 160 Leu Phe Tyr Ile Gly Asp Arg Lys Gln Thr Thr Leu Pro Tyr Gln Ser 165 170 175 Asp Glu Gln Ser Asp Cys Gly Trp Phe Arg Leu Arg His Glu Glu Ala 180 185 190 Leu Thr Pro Glu Ala Ile Val Arg Leu Ala Glu Ser Ala Gln Glu Arg 195 200 205 Tyr Gly Phe Gln Asp Phe Lys Leu Lys Gly Gly Val Leu Arg Gly Glu 210 215 220 Asp Glu Ile Glu Ala Val Thr Ala Leu Ala Lys Arg Phe Pro Glu Ala 225 230 235 240 Arg Ile Thr Leu Asp Pro Asn Gly Ala Trp Ser Leu Glu Glu Ala Ile 245 250 255 Ala Leu Cys Lys Gly Lys His Asp Val Leu Ala Tyr Ala Glu Asp Pro 260 265 270 Cys Gly Asp Glu Asn Gly Tyr Ser Ala Arg Glu Val Met Ala Glu Phe 275 280 285 Arg Arg Ala Thr Gly Leu Pro Thr Ala Thr Asn Met Ile Ala Thr Asp 290 295 300 Trp Arg Glu Met Gly His Ala Ile Gln Leu His Ala Val Asp Ile Pro 305 310 315 320 Leu Ala Asp Pro His Phe Trp Thr Met Gln Gly Ser Val Arg Val Ala 325 330 335 Gln Met Cys His Asp Trp Gly Leu Thr Trp Gly Ser His Ser Asn Asn 340 345 350 His Phe Asp Ile Ser Leu Ala Met Phe Thr His Val Ala Ala Ala Ala 355 360 365 Pro Gly Arg Ile Thr Ala Ile Asp Thr His Trp Ile Trp Gln Asp Gly 370 375 380 Gln Arg Leu Thr Lys Gln Pro Phe Glu Ile Ser Glu Gly Cys Val Lys 385 390 395 400 Val Pro Asn Lys Pro Gly Leu Gly Ile Asp Ile Asp Met Glu Gln Val 405 410 415 Glu Lys Ala His Glu Leu Tyr Arg Lys Met Asn Leu Gly Ala Arg Asn 420 425 430 Asp Ala Val Pro Met Gln Phe Leu Ile Ser Asn Trp Glu Phe Asp Arg 435 440 445 Lys Arg Pro Cys Leu Val Arg 450 455 70455PRTBacillus subtilis 70Met Ser Ser Pro Met Gln Glu Gln Ile Gln Lys Glu Lys Arg Ser Asn 1 5 10 15 Val Pro Ser Ile Ser Glu Met Lys Val Ile Pro Val Ala Gly His Asp 20 25 30 Ser Met Leu Leu Asn Leu Ser Gly Ala His Ser Pro Phe Phe Thr Arg 35 40 45 Asn Ile Val Ile Leu Thr Asp Ser Ser Gly Asn Gln Gly Val Gly Glu 50 55 60 Val Pro Gly Gly Glu His Ile Arg Arg Thr Leu Glu Leu Ser Glu Pro 65 70 75 80 Leu Val Val Gly Lys Ser Ile Gly Ala Tyr Gln Ala Ile Leu Gln Thr 85 90 95 Val Arg Lys Gln Phe Gly Asp Gln Asp Arg Gly Gly Arg Gly Asn Gln 100 105 110 Thr Phe Asp Leu Arg Thr Thr Val His Ala Val Thr Ala Leu Glu Ala 115 120 125 Ala Leu Leu Asp Leu Leu Gly Lys Phe Leu Gln Glu Pro Val Ala Ala 130 135 140 Leu Leu Gly Glu Gly Lys Gln Arg Asp Glu Val Lys Met Leu Gly Tyr 145 150 155 160 Leu Phe Tyr Ile Gly Asp Arg Lys Arg Thr Thr Leu Pro Tyr Gln Ser 165 170 175 Asp Glu Gln Ser Tyr Cys Ala Trp Phe Arg Leu Arg His Glu Glu Ala 180 185 190 Leu Thr Pro Glu Ala Ile Val Arg Leu Ala Glu Ser Ala Gln Glu Arg 195 200 205 Tyr Gly Phe Gln Asp Phe Lys Leu Lys Gly Gly Val Leu Arg Gly Glu 210 215 220 Glu Glu Ile Glu Ala Val Thr Ala Leu Ser Lys Arg Phe Pro Glu Ala 225 230 235 240 Arg Ile Thr Leu Asp Pro Asn Gly Ala Trp Ser Leu Glu Glu Ala Ile 245 250 255 Ala Leu Cys Lys Gly Lys Gln Asp Val Leu Ala Tyr Ala Glu Asp Pro 260 265 270 Cys Gly Asp Glu Asn Gly Tyr Ser Ala Arg Glu Val Met Ala Glu Phe 275 280 285 Arg Arg Ala Thr Gly Leu Pro Thr Ala Thr Asn Met Ile Ala Thr Asp 290 295 300 Trp Arg Glu Met Gly His Ala Ile Gln Leu His Ala Val Asp Ile Pro 305 310 315 320 Leu Ala Asp Pro His Phe Trp Thr Met Gln Gly Ser Val Arg Val Ala 325 330 335 Gln Met Cys Asn Asp Trp Gly Leu Thr Trp Gly Ser His Ser Asn Asn 340 345 350 His Phe Asp Ile Ser Leu Ala Met Phe Thr His Val Ala Ala Ala Ala 355 360 365 Pro Gly Arg Ile Thr Ala Ile Asp Thr His Trp Ile Trp Gln Asp Gly 370 375 380 Gln Arg Leu Thr Lys Gln Pro Phe Glu Ile Ser Ser Gly Cys Val Lys 385 390 395 400 Val Pro Asp

Lys Pro Gly Leu Gly Val Asp Ile Asp Met Glu Gln Val 405 410 415 Glu Lys Ala His Glu Ile Tyr Arg Lys Met Asn Leu Gly Ala Arg Asn 420 425 430 Asp Ala Ile Pro Met Gln Ser Leu Ile Ser Asn Trp Glu Phe Asp Arg 435 440 445 Lys Arg Pro Cys Leu Val Arg 450 455 71510PRTBacillus subtilis 71Met Ala Met Asn Leu Arg Lys Asn Gln Ala Pro Leu Tyr Ile Lys Val 1 5 10 15 His Glu Ile Asp Asn Thr Ala Ile Ile Val Asn Asp Gly Gly Leu Pro 20 25 30 Lys Gly Thr Val Phe Ser Cys Gly Leu Val Leu Glu Glu Asp Val Pro 35 40 45 Gln Gly His Lys Val Ala Leu Thr Asp Leu Asn Gln Gly Asp Glu Ile 50 55 60 Val Arg Tyr Gly Glu Val Ile Gly Phe Ala Asp Glu Thr Ile Lys Arg 65 70 75 80 Gly Ser Trp Ile Arg Glu Ala Leu Val Arg Met Pro Ala Pro Pro Ala 85 90 95 Leu Asp Asp Leu Pro Leu Ala Asn Arg Val Pro Gln Pro Arg Pro Pro 100 105 110 Leu Glu Gly Tyr Thr Phe Glu Gly Tyr Arg Asn Ala Asp Gly Ser Ala 115 120 125 Gly Thr Lys Asn Ile Leu Gly Ile Thr Thr Ser Val Gln Cys Val Val 130 135 140 Gly Val Leu Asp Tyr Ala Val Lys Arg Ile Lys Glu Glu Leu Leu Pro 145 150 155 160 Lys Tyr Pro Asn Val Asp Asp Val Val Pro Leu His His Gln Tyr Gly 165 170 175 Cys Gly Val Ala Ile Asn Ala Pro Asp Ala Val Ile Pro Ile Arg Thr 180 185 190 Ile Gln Asn Leu Ala Lys His Pro Asn Phe Gly Gly Glu Val Met Val 195 200 205 Ile Gly Leu Gly Cys Glu Lys Leu Leu Pro Glu Arg Ile Ala Ser Glu 210 215 220 Asn Asp Asp Asp Ile Leu Ser Leu Gln Asp His Arg Gly Phe Ala Ala 225 230 235 240 Met Ile Gln Ser Ile Leu Glu Met Ala Glu Glu Arg Leu Ile Arg Leu 245 250 255 Asn Ser Arg Thr Arg Val Ser Cys Pro Val Ser Asp Leu Val Ile Gly 260 265 270 Leu Gln Cys Gly Gly Ser Asp Ala Phe Ser Gly Val Thr Ala Asn Pro 275 280 285 Ala Val Gly Tyr Ala Ala Asp Leu Leu Val Arg Ala Gly Ala Thr Val 290 295 300 Leu Phe Ser Glu Val Thr Glu Val Arg Asp Ala Ile His Leu Leu Thr 305 310 315 320 Pro Arg Ala Val Ser Glu Glu Val Gly Gln Ser Leu Ile Lys Glu Met 325 330 335 Lys Trp Tyr Asp Ser Tyr Leu Arg Arg Gly Asp Ala Asp Arg Ser Ala 340 345 350 Asn Pro Ser Pro Gly Asn Lys Lys Gly Gly Leu Ser Asn Val Val Glu 355 360 365 Lys Ala Leu Gly Ser Val Ala Lys Ser Gly Thr Ser Pro Ile Ser Gly 370 375 380 Val Leu Gly Pro Gly Glu Arg Ala Lys Gln Lys Gly Leu Leu Phe Ala 385 390 395 400 Ala Thr Pro Ala Ser Asp Phe Val Cys Gly Thr Leu Gln Leu Ala Ala 405 410 415 Gly Met Asn Leu Gln Val Phe Thr Thr Gly Arg Gly Thr Pro Tyr Gly 420 425 430 Leu Ala Ala Ala Pro Val Leu Lys Val Ser Thr Arg His Ser Leu Ser 435 440 445 Glu His Trp Ala Asp Leu Ile Asp Ile Asn Ala Gly Arg Ile Ala Thr 450 455 460 Gly Glu Ala Ser Ile Glu Asp Val Gly Trp Glu Ile Phe Arg Thr Ile 465 470 475 480 Leu Asp Val Ala Ser Gly Arg Lys Gln Thr Trp Ala Asp Arg Trp Gly 485 490 495 Leu His Asn Asp Leu Cys Leu Phe Asn Pro Ala Pro Val Thr 500 505 510 72510PRTBacillus subtilis 72Met Ala Met Asn Leu Arg Lys Asn Gln Ala Pro Leu Tyr Ile Lys Val 1 5 10 15 His Glu Ile Asp Asn Thr Ala Ile Ile Val Asn Asp Gly Gly Leu Pro 20 25 30 Lys Gly Thr Val Phe Ser Cys Gly Leu Val Leu Glu Glu Asp Val Pro 35 40 45 Gln Gly His Lys Val Ala Leu Thr Asp Leu Asn Gln Gly Asp Glu Ile 50 55 60 Val Arg Tyr Gly Glu Val Ile Gly Phe Ala Asp Glu Thr Ile Lys Arg 65 70 75 80 Gly Ser Trp Ile Arg Glu Ala Leu Val Arg Met Pro Ala Pro Pro Ala 85 90 95 Leu Asp Asp Leu Pro Leu Ala Asn Arg Val Pro Gln Pro Arg Pro Pro 100 105 110 Leu Glu Gly Tyr Thr Phe Glu Gly Tyr Arg Asn Ala Asp Gly Ser Ala 115 120 125 Gly Thr Lys Asn Ile Leu Gly Ile Thr Thr Ser Val Gln Cys Val Val 130 135 140 Gly Val Leu Asp Tyr Ala Val Lys Arg Ile Lys Glu Glu Leu Leu Pro 145 150 155 160 Lys Tyr Pro Asn Val Asp Asp Val Val Pro Leu His His Gln Tyr Gly 165 170 175 Cys Gly Val Ala Ile Asn Ala Pro Asp Ala Val Ile Pro Ile Arg Thr 180 185 190 Ile Gln Asn Leu Ala Lys His Pro Asn Phe Gly Gly Glu Val Met Val 195 200 205 Ile Gly Leu Gly Cys Glu Lys Leu Leu Pro Glu Arg Ile Ala Ser Glu 210 215 220 Asn Asp Asp Asp Ile Leu Ser Leu Gln Asp His Arg Gly Phe Ala Ala 225 230 235 240 Met Ile Gln Ser Ile Leu Glu Met Ala Glu Glu Arg Leu Ile Arg Leu 245 250 255 Asn Ser Arg Thr Arg Val Ser Cys Pro Val Ser Asp Leu Val Ile Gly 260 265 270 Leu Gln Cys Gly Gly Ser Asp Ala Phe Ser Gly Val Thr Ala Asn Pro 275 280 285 Ala Val Gly Tyr Ala Ala Asp Leu Leu Val Arg Ala Gly Ala Thr Val 290 295 300 Leu Phe Ser Glu Val Thr Glu Val Arg Asp Ala Ile His Leu Leu Thr 305 310 315 320 Pro Arg Ala Val Ser Glu Glu Val Gly Gln Ser Leu Ile Lys Glu Met 325 330 335 Lys Trp Tyr Asp Ser Tyr Leu Arg Arg Gly Asp Ala Asp Arg Ser Ala 340 345 350 Asn Pro Ser Pro Gly Asn Lys Lys Gly Gly Leu Ser Asn Val Val Glu 355 360 365 Lys Ala Leu Gly Ser Val Ala Lys Ser Gly Thr Ser Pro Ile Ser Gly 370 375 380 Val Leu Gly Pro Gly Glu Arg Ala Glu Gln Lys Gly Leu Leu Phe Ala 385 390 395 400 Ala Thr Pro Ala Ser Asp Phe Val Cys Gly Thr Leu Gln Leu Ala Ala 405 410 415 Gly Met Asn Leu Gln Val Phe Thr Thr Gly Arg Gly Thr Pro Tyr Gly 420 425 430 Leu Ala Ala Ala Pro Val Leu Lys Val Ser Thr Arg His Ser Leu Ser 435 440 445 Glu His Trp Ala Asp Leu Ile Asp Ile Asn Ala Gly Arg Ile Ala Thr 450 455 460 Gly Glu Ala Ser Ile Glu Asp Val Gly Trp Glu Ile Phe Arg Thr Ile 465 470 475 480 Leu Asp Val Ala Ser Gly Arg Lys Gln Thr Trp Ala Asp Arg Trp Gly 485 490 495 Leu His Asn Asp Leu Cys Leu Phe Asn Pro Ala Pro Val Thr 500 505 510 73510PRTBacillus subtilis 73Met Ala Met Asn Leu Arg Lys Asn Gln Ala Pro Leu Tyr Ile Lys Val 1 5 10 15 His Glu Ile Asp Asn Thr Ala Ile Ile Val Asn Asp Gly Gly Leu Pro 20 25 30 Lys Gly Thr Val Phe Ser Cys Gly Leu Val Leu Glu Glu Asp Val Pro 35 40 45 Gln Gly His Lys Val Ala Leu Thr Asp Leu Asn Gln Gly Asp Glu Ile 50 55 60 Val Arg Tyr Gly Glu Val Ile Gly Phe Ala Asp Glu Thr Ile Lys Arg 65 70 75 80 Gly Ser Trp Ile Arg Glu Ala Leu Val Arg Met Pro Ala Pro Pro Ala 85 90 95 Leu Asp Asp Leu Pro Leu Ala Asn Arg Val Pro Gln Pro Arg Pro Pro 100 105 110 Leu Glu Gly Tyr Thr Phe Glu Gly Tyr Arg Asn Ala Asp Gly Ser Ala 115 120 125 Gly Thr Lys Asn Ile Leu Gly Ile Thr Thr Ser Val Gln Cys Val Val 130 135 140 Gly Val Leu Asp Tyr Ala Val Lys Arg Ile Lys Glu Glu Leu Leu Pro 145 150 155 160 Lys Tyr Pro Asn Val Asp Asp Val Val Pro Leu His His Gln Tyr Gly 165 170 175 Cys Gly Val Ala Ile Asn Ala Pro Asp Ala Val Ile Pro Ile Arg Thr 180 185 190 Ile Gln Asn Leu Ala Lys His Pro Asn Phe Gly Gly Glu Val Met Val 195 200 205 Ile Gly Leu Gly Cys Glu Lys Leu Leu Pro Glu Arg Ile Ala Ser Glu 210 215 220 Asn Asp Asp Asp Ile Leu Ser Leu Gln Asp His Arg Gly Phe Ala Ala 225 230 235 240 Met Ile Gln Ser Ile Leu Glu Met Ala Glu Glu Arg Leu Ile Arg Leu 245 250 255 Asn Ser Arg Thr Arg Val Ser Cys Pro Val Ser Asp Leu Val Ile Gly 260 265 270 Leu Gln Cys Gly Gly Ser Asp Ala Phe Ser Gly Val Thr Ala Asn Pro 275 280 285 Ala Val Gly Tyr Ala Ala Asp Leu Leu Val Arg Ala Gly Ala Thr Val 290 295 300 Leu Phe Ser Glu Val Thr Glu Val Arg Asp Ala Ile His Leu Leu Thr 305 310 315 320 Pro Arg Ala Val Ser Glu Glu Val Gly Gln Ser Leu Ile Glu Glu Met 325 330 335 Lys Trp Tyr Asp Ser Tyr Leu Arg Arg Gly Asp Ala Asp Arg Ser Ala 340 345 350 Asn Pro Ser Pro Gly Asn Lys Lys Gly Gly Leu Ser Asn Val Val Glu 355 360 365 Lys Ala Leu Gly Ser Val Ala Lys Ser Gly Thr Ser Pro Ile Ser Gly 370 375 380 Val Leu Gly Pro Gly Glu Arg Ala Glu Gln Lys Gly Leu Leu Phe Ala 385 390 395 400 Ala Thr Pro Ala Ser Asp Phe Val Cys Gly Thr Leu Gln Leu Ala Ala 405 410 415 Gly Met Asn Leu Gln Val Phe Thr Thr Gly Arg Gly Thr Pro Tyr Gly 420 425 430 Leu Ala Ala Ala Pro Val Leu Lys Val Ser Thr Arg His Ser Leu Ser 435 440 445 Glu His Trp Ala Asp Leu Ile Asp Ile Asn Ala Gly Arg Ile Ala Thr 450 455 460 Gly Glu Ala Ser Ile Glu Asp Val Gly Trp Glu Ile Phe Arg Thr Ile 465 470 475 480 Leu Asp Val Ala Ser Gly Arg Lys Gln Thr Trp Ala Asp Arg Trp Gly 485 490 495 Leu His Asn Asp Leu Cys Leu Phe Asn Pro Ala Pro Val Thr 500 505 510 74510PRTBacillus subtilis 74Met Ala Met Asn Leu Arg Lys Asn Gln Ala Pro Leu Tyr Ile Lys Val 1 5 10 15 His Glu Ile Asp Asn Thr Ala Ile Ile Val Asn Glu Gly Gly Leu Pro 20 25 30 Lys Gly Thr Val Phe Ser Cys Gly Leu Val Leu Glu Glu Asp Val Pro 35 40 45 Gln Gly His Lys Val Ala Leu Thr Asp Leu Asn Gln Gly Asp Glu Ile 50 55 60 Val Arg Tyr Gly Glu Val Ile Gly Phe Ala Asp Glu Thr Ile Lys Arg 65 70 75 80 Gly Ser Trp Ile Arg Glu Ala Leu Val Arg Met Pro Ala Pro Pro Ala 85 90 95 Leu Asp Asp Leu Pro Leu Glu Asn Arg Val Pro Gln Pro Arg Pro Pro 100 105 110 Leu Glu Gly Tyr Thr Phe Glu Gly Tyr Arg Asn Ala Asp Gly Ser Ala 115 120 125 Gly Thr Lys Asn Ile Leu Gly Ile Thr Thr Ser Val Gln Cys Val Val 130 135 140 Gly Val Leu Asp Tyr Ala Val Lys Arg Ile Lys Glu Glu Leu Leu Pro 145 150 155 160 Lys Tyr Pro Asn Val Asp Asp Val Val Pro Leu His His Gln Tyr Gly 165 170 175 Cys Gly Val Ala Ile Asn Ala Pro Asp Ala Val Ile Pro Ile Arg Thr 180 185 190 Ile Gln Asn Leu Ala Lys His Pro Asn Phe Gly Gly Glu Val Met Val 195 200 205 Ile Gly Leu Gly Cys Glu Lys Leu Leu Pro Glu Arg Ile Ala Ser Glu 210 215 220 Asn Asp Asp Asp Ile Leu Ser Leu Gln Asp His Arg Gly Phe Ala Ala 225 230 235 240 Met Ile Gln Ser Ile Leu Glu Met Ala Glu Glu Arg Leu Ile Arg Leu 245 250 255 Asn Ser Arg Thr Arg Val Ser Cys Pro Val Ser Asp Leu Val Ile Gly 260 265 270 Leu Gln Cys Gly Gly Ser Asp Ala Phe Ser Gly Val Thr Ala Asn Pro 275 280 285 Ala Val Gly Tyr Ala Ala Asp Leu Leu Val Arg Ala Gly Ala Thr Val 290 295 300 Leu Phe Ser Glu Val Thr Glu Val Arg Asp Ala Ile His Leu Leu Thr 305 310 315 320 Pro Arg Ala Val Ser Glu Glu Val Gly Gln Ser Leu Ile Lys Glu Met 325 330 335 Lys Trp Tyr Asp Ser Tyr Leu Arg Arg Gly Asp Ala Asp Arg Ser Ala 340 345 350 Asn Pro Ser Pro Gly Asn Lys Lys Gly Gly Leu Ser Asn Val Val Glu 355 360 365 Lys Ala Leu Gly Ser Val Ala Lys Ser Gly Thr Ser Pro Ile Ser Gly 370 375 380 Val Leu Gly Pro Gly Glu Arg Ala Glu Gln Lys Gly Leu Leu Phe Ala 385 390 395 400 Ala Thr Pro Ala Ser Asp Phe Val Cys Gly Thr Leu Gln Leu Ala Ala 405 410 415 Gly Met Asn Leu Gln Val Phe Thr Thr Gly Arg Gly Thr Pro Tyr Gly 420 425 430 Leu Ala Ala Ala Pro Val Leu Lys Val Ser Thr Arg His Ser Leu Ser 435 440 445 Glu His Trp Ala Asp Leu Ile Asp Ile Asn Ala Gly Gln Ile Ala Thr 450 455 460 Gly Glu Ala Ser Ile Glu Asp Val Gly Trp Glu Ile Phe Arg Thr Ile 465 470 475 480 Leu Asp Val Ala Ser Gly Arg Lys Gln Thr Trp Ala Asp Arg Trp Gly 485 490 495 Leu His Asn Asp Leu Cys Leu Phe Asn Pro Ala Pro Val Thr 500 505 510 75510PRTBacillus subtilis 75Met Ala Met Asn Leu Arg Lys Asn Gln Ala Pro Leu Tyr Ile Lys Val 1 5 10 15 His Glu Ile Asp Asn Thr Ala Ile Ile Val Asn Asp Gly Gly Leu Pro 20 25 30 Lys Gly Thr Val Phe Ser Cys Gly Leu Val Leu Glu Glu Asp Val Pro 35 40 45 Gln Gly His Lys Val Ala Leu Thr Asp Leu Asn Gln Gly Asp Glu Ile 50 55 60 Val Arg Tyr Gly Glu Val Ile Gly Phe Ala Asp Glu Thr Ile Lys Arg 65 70 75 80 Gly Ser Trp Ile Arg Glu Asp Leu Val Arg Met Pro Ala Pro Pro Ala 85 90 95 Leu Asp Asp Leu Pro Leu Ala Asn Arg Val Pro Gln Pro Arg Pro Ser 100 105 110 Leu Glu Gly Tyr Thr Phe Glu Gly Tyr Arg Asn Ala Asp Gly Ser Thr 115 120 125 Gly Thr Lys Asn Ile Leu Gly Ile Thr Thr Ser Val Gln Cys Val Val 130 135 140 Gly Val Leu Asp Tyr Ala Val Lys Arg Ile Lys Glu Glu Leu Leu Pro 145 150 155 160 Lys Tyr Pro Asn Val Asp Asp Val Val Pro Leu His His Gln Tyr Gly 165 170 175 Cys Gly Val Ala Ile Asn Ala Pro Asp Ala Val Ile Pro Ile Arg Thr 180 185

190 Ile Gln Asn Leu Ala Lys His Pro Asn Phe Gly Gly Glu Val Met Val 195 200 205 Ile Gly Leu Gly Cys Glu Lys Leu Leu Pro Glu Arg Ile Ala Ser Glu 210 215 220 Asn Gly Asp Asp Ile Leu Ser Leu Gln Asp His Arg Gly Phe Ala Ala 225 230 235 240 Met Ile Gln Ser Ile Leu Glu Met Ala Glu Glu Arg Leu Ile Arg Leu 245 250 255 Asn Ser Arg Thr Arg Val Ser Cys Pro Val Ser Asp Leu Val Ile Gly 260 265 270 Leu Gln Cys Gly Gly Ser Asp Ala Phe Ser Gly Val Thr Ala Asn Pro 275 280 285 Ala Val Gly Tyr Ala Ala Asp Leu Leu Val Arg Ala Gly Ala Thr Val 290 295 300 Leu Phe Ser Glu Val Thr Glu Val Arg Asp Ala Ile His Leu Leu Thr 305 310 315 320 Pro Arg Ala Val Ser Glu Glu Val Gly Gln Ser Leu Ile Lys Glu Met 325 330 335 Lys Trp Tyr Asp Ser Tyr Leu Arg Arg Gly Asp Ala Asp Arg Ser Ala 340 345 350 Asn Pro Ser Pro Gly Asn Lys Lys Gly Gly Leu Ser Asn Val Val Glu 355 360 365 Lys Ala Leu Gly Ser Val Ala Lys Ser Gly Thr Ser Pro Ile Ser Gly 370 375 380 Val Leu Gly Pro Gly Glu Arg Ala Lys Gln Lys Gly Leu Leu Phe Ala 385 390 395 400 Ala Thr Pro Ala Ser Asp Phe Val Cys Gly Thr Leu Gln Leu Ala Ala 405 410 415 Gly Met Asn Leu Gln Val Phe Thr Thr Gly Arg Gly Thr Pro Tyr Gly 420 425 430 Leu Ala Ala Ala Pro Val Leu Lys Val Ser Thr Arg His Ser Leu Ser 435 440 445 Glu His Trp Ala Asp Leu Ile Asp Ile Asn Ala Gly Arg Ile Ala Thr 450 455 460 Gly Glu Ala Ser Ile Glu Asp Val Gly Trp Glu Ile Phe Arg Thr Ile 465 470 475 480 Leu Asp Val Ala Ser Gly Arg Lys Gln Thr Trp Ala Asp Arg Trp Gly 485 490 495 Leu His Asn Asp Leu Cys Leu Phe Asn Pro Ala Pro Val Thr 500 505 510 76308PRTBacillus subtilis 76Met Ser Arg Ile Arg Lys Ala Pro Ala Gly Ile Leu Gly Phe Pro Val 1 5 10 15 Ala Pro Phe Asn Thr Gln Gly Lys Leu Glu Glu Glu Ala Leu Phe Gln 20 25 30 Asn Ile Glu Phe Leu Leu Asn Glu Gly Leu Glu Ala Ile Phe Ile Ala 35 40 45 Cys Gly Ser Gly Glu Phe Gln Ser Leu Ser Gln Lys Glu Tyr Glu Gln 50 55 60 Met Val Glu Val Ala Val Ser Ala Ala Gly Gly Lys Val Pro Val Tyr 65 70 75 80 Thr Gly Val Gly Gly Asn Leu Ser Thr Ala Leu Asp Trp Ala Gln Leu 85 90 95 Ser Glu Lys Lys Gly Ala Asp Gly Tyr Leu Ile Leu Pro Pro Tyr Leu 100 105 110 Val His Gly Glu Gln Glu Gly Leu Tyr Gln Tyr Ala Lys Thr Ile Ile 115 120 125 Glu Ser Thr Asp Leu Asn Ala Ile Leu Tyr Gln Arg Asp Asn Ala Val 130 135 140 Leu Ser Val Glu Gln Ile Lys Arg Leu Thr Glu Cys Glu Gln Leu Val 145 150 155 160 Gly Val Lys Asp Gly Val Gly Asn Met Asp Leu Asn Ile Asn Leu Val 165 170 175 Tyr Thr Ile Gly Asp Arg Leu Gly Trp Leu Asn Gly Met Pro Met Ala 180 185 190 Glu Val Thr Met Pro Ala Tyr Leu Pro Ile Gly Phe His Ser Tyr Ser 195 200 205 Ser Ala Ile Ser Asn Tyr Ile Pro His Ile Ser Arg Met Phe Tyr Asp 210 215 220 Ala Leu Lys Asn Gly Asn Asp Glu Leu Val Lys Glu Leu Tyr Arg His 225 230 235 240 Val Ile Leu Pro Ile Asn Asp Ile Arg Lys Gln Arg Lys Gly Tyr Ala 245 250 255 Val Ser Leu Ile Lys Ala Gly Met Glu Ile Met Gly Leu Asn Val Arg 260 265 270 Asn Thr Ala Arg Pro Pro Val Gly Pro Val Glu Lys Asp His Tyr Gln 275 280 285 Gln Leu Glu Ala Ile Leu Lys Gln Ala Ala Asp Arg Phe Pro Lys Lys 290 295 300 Ala Ala Thr Val 305 77308PRTBacillus subtilis 77Met Ser Arg Ile Arg Lys Ala Pro Ala Gly Ile Leu Gly Phe Pro Val 1 5 10 15 Ala Pro Phe Asn Thr Gln Gly Lys Leu Glu Glu Glu Ala Leu Phe Gln 20 25 30 Asn Ile Glu Phe Leu Leu Asn Glu Gly Leu Glu Ala Ile Phe Ile Ala 35 40 45 Cys Gly Ser Gly Glu Phe Gln Ser Leu Ser Gln Lys Glu Tyr Glu Gln 50 55 60 Met Val Glu Val Ala Val Ser Ala Ala Gly Gly Lys Val Pro Val Tyr 65 70 75 80 Thr Gly Val Gly Gly Asn Leu Ser Thr Ala Leu Glu Trp Ala Gln Leu 85 90 95 Ser Glu Lys Lys Gly Ala Asp Gly Tyr Leu Ile Leu Pro Pro Tyr Leu 100 105 110 Val His Gly Glu Gln Glu Gly Leu Tyr Gln Tyr Ala Lys Thr Ile Ile 115 120 125 Glu Ser Thr Asp Leu Asn Ala Ile Leu Tyr Gln Arg Asp Asn Ala Val 130 135 140 Leu Ser Val Glu Gln Ile Lys Arg Leu Thr Glu Cys Glu Gln Leu Val 145 150 155 160 Gly Val Lys Asp Gly Val Gly Asn Met Asp Leu Asn Ile Asn Leu Val 165 170 175 Tyr Thr Ile Gly Asp Arg Leu Gly Trp Leu Asn Gly Met Pro Met Ala 180 185 190 Glu Val Thr Met Pro Ala Tyr Leu Pro Ile Gly Phe His Ser Tyr Ser 195 200 205 Ser Ala Ile Ser Asn Tyr Ile Pro His Ile Ser Arg Met Phe Tyr Asp 210 215 220 Ala Leu Lys Asn Gly Asn Asp Glu Leu Val Lys Glu Leu Tyr Arg His 225 230 235 240 Val Ile Leu Pro Ile Asn Asp Ile Arg Lys Gln Arg Lys Gly Tyr Ala 245 250 255 Val Ser Leu Ile Lys Ala Gly Met Glu Ile Met Gly Leu Asn Val Arg 260 265 270 Asn Thr Ala Arg Pro Pro Val Gly Pro Val Glu Lys Asp His Tyr Gln 275 280 285 Gln Leu Glu Ala Ile Leu Lys Gln Ala Ala Asp Arg Phe Pro Lys Lys 290 295 300 Ala Ala Thr Val 305 78308PRTBacillus vallismortis 78Met Asn Arg Ile Arg Lys Ala Pro Thr Gly Ile Leu Gly Phe Pro Val 1 5 10 15 Ala Pro Phe Asn Thr Gln Gly Gln Leu Glu Glu Glu Ala Leu Phe Gln 20 25 30 Asn Ile Glu Phe Leu Leu Glu Glu Gly Leu Glu Ala Ile Phe Ile Ala 35 40 45 Cys Gly Ser Gly Glu Phe Gln Ser Leu Ser Gln Lys Glu Tyr Glu Gln 50 55 60 Met Val Glu Val Ala Val Ser Ala Ala Glu Gly Lys Val Pro Val Tyr 65 70 75 80 Thr Gly Val Gly Gly Asn Leu Ser Thr Ala Leu Glu Trp Ala Arg Leu 85 90 95 Ser Glu Lys Lys Gly Ala Asp Gly Tyr Leu Ile Leu Pro Pro Tyr Leu 100 105 110 Val His Gly Glu Gln Glu Gly Leu Tyr Gln Tyr Ala Lys Thr Ile Ile 115 120 125 Glu Ser Thr Asp Leu Asn Ala Ile Leu Tyr Gln Arg Asp Asn Ala Val 130 135 140 Leu Ser Leu Glu Gln Ile Lys Arg Leu Thr Glu Cys Glu Gln Leu Val 145 150 155 160 Gly Val Lys Asp Gly Val Gly Asn Met Asp Leu Asn Ile Asn Leu Val 165 170 175 Tyr Thr Leu Gly Asp Arg Leu Gly Trp Leu Asn Gly Met Pro Met Ala 180 185 190 Glu Val Thr Met Pro Ala Tyr Leu Pro Ile Gly Phe His Ser Tyr Ser 195 200 205 Ser Ala Ile Ser Asn Tyr Ile Pro His Ile Ser Arg Met Phe Tyr Asp 210 215 220 Ala Leu Lys Asn Gly Asn Asp Glu Leu Val Lys Glu Leu Tyr Gln His 225 230 235 240 Val Ile Leu Pro Ile Asn Asp Ile Arg Lys Gln Arg Lys Gly Tyr Ala 245 250 255 Val Ser Leu Ile Lys Ala Gly Met Glu Ile Met Gly Leu Asn Val Arg 260 265 270 Asn Thr Ala Arg Pro Pro Val Gly Pro Val Glu Lys Glu His Tyr Arg 275 280 285 Gln Leu Glu Ala Ile Leu Lys Gln Ala Ala Asp Arg Phe Pro Lys Lys 290 295 300 Ala Ala Thr Val 305 79308PRTBacillus subtilis 79Met Ser Arg Ile Arg Lys Ala Pro Ala Gly Ile Leu Gly Phe Pro Val 1 5 10 15 Ala Pro Phe Asn Thr Gln Gly Lys Leu Glu Glu Glu Ala Leu Phe Gln 20 25 30 Asn Ile Glu Phe Leu Leu Glu Glu Gly Leu Glu Ala Ile Phe Ile Ala 35 40 45 Cys Gly Ser Gly Glu Phe Gln Ser Leu Ser Gln Lys Glu Tyr Glu Gln 50 55 60 Met Val Glu Val Ala Ile Ser Ala Ala Gly Gly Lys Val Pro Val Tyr 65 70 75 80 Thr Gly Val Gly Gly Asn Leu Ser Thr Ala Leu Glu Trp Ala Gln Leu 85 90 95 Ser Glu Lys Lys Gly Ala Asp Gly Tyr Leu Ile Leu Pro Pro Tyr Leu 100 105 110 Val His Gly Glu Gln Glu Gly Leu Tyr Gln Tyr Ala Lys Thr Ile Ile 115 120 125 Glu Ser Thr Asp Leu Asn Ala Ile Leu Tyr Gln Arg Asp Asn Ala Val 130 135 140 Leu Ser Val Glu Gln Ile Lys Arg Leu Thr Glu Phe Glu Gln Leu Val 145 150 155 160 Gly Val Lys Asp Gly Val Gly Asn Met Asp Leu Asn Ile Asn Leu Val 165 170 175 Tyr Thr Leu Gly Asp Arg Leu Gly Trp Leu Asn Gly Met Pro Met Ala 180 185 190 Glu Val Thr Met Pro Ala Tyr Leu Pro Ile Gly Phe His Ser Tyr Ser 195 200 205 Ser Ala Ile Ser Asn Tyr Ile Pro His Ile Ser Arg Met Phe Tyr Asp 210 215 220 Ala Leu Lys Asn Gly Asp Asp Glu Leu Val Lys Glu Leu Tyr Gln His 225 230 235 240 Val Ile Leu Pro Ile Asn Asp Ile Arg Lys Gln Arg Lys Gly Tyr Ala 245 250 255 Val Ser Leu Ile Lys Ala Gly Met Glu Ile Met Gly Leu Asn Val Arg 260 265 270 Asn Thr Ala Arg Pro Pro Val Gly Pro Val Glu Lys Asp His Tyr Gln 275 280 285 Gln Leu Glu Ala Ile Leu Lys Gln Ala Ala Asp Arg Phe Pro Lys Lys 290 295 300 Ala Ala Thr Val 305 80308PRTBacillus subtilis 80Met Ser Arg Ile Arg Lys Ala Pro Ala Gly Ile Leu Gly Phe Pro Val 1 5 10 15 Ala Pro Phe Asn Thr Gln Gly Thr Leu Glu Glu Glu Ala Leu Phe Gln 20 25 30 Asn Ile Glu Phe Leu Leu Asn Glu Gly Leu Glu Ala Ile Phe Ile Ala 35 40 45 Cys Gly Ser Gly Glu Phe Gln Ser Leu Ser Gln Lys Glu Tyr Glu Gln 50 55 60 Met Val Glu Val Ala Val Ser Ala Ala Gly Gly Lys Val Pro Val Tyr 65 70 75 80 Thr Gly Val Gly Gly Asn Leu Ser Thr Ala Leu Asp Trp Ala Gln Leu 85 90 95 Ser Glu Lys Lys Gly Ala Asp Gly Tyr Leu Ile Leu Pro Pro Tyr Leu 100 105 110 Val His Gly Glu Gln Glu Gly Leu Tyr Gln Tyr Ala Lys Thr Ile Ile 115 120 125 Glu Ser Thr Asp Leu Asn Ala Ile Leu Tyr Gln Arg Asp Asn Ala Val 130 135 140 Leu Ser Val Glu Gln Ile Lys Arg Leu Thr Glu Cys Glu Gln Leu Val 145 150 155 160 Gly Val Lys Asp Gly Val Gly Asn Met Asp Leu Asn Ile Asn Leu Val 165 170 175 Tyr Thr Ile Gly Asp Arg Leu Gly Trp Leu Asn Gly Met Pro Met Ala 180 185 190 Glu Val Thr Met Pro Ala Tyr Leu Pro Ile Gly Phe His Ser Tyr Ser 195 200 205 Ser Ala Ile Ser Asn Tyr Ile Pro His Ile Ser Arg Met Phe Tyr Asp 210 215 220 Ala Leu Lys Asn Gly Asn Asp Glu Leu Val Lys Glu Leu Tyr Arg His 225 230 235 240 Val Ile Leu Pro Ile Asn Asp Ile Arg Lys Gln Arg Lys Gly Tyr Ala 245 250 255 Val Ser Leu Ile Lys Ala Gly Met Glu Ile Met Gly Leu Asn Val Arg 260 265 270 Asn Thr Ala Arg Pro Pro Val Gly Pro Val Glu Lys Asp His Tyr Gln 275 280 285 Gln Leu Glu Ala Ile Leu Lys Gln Pro Ala Asp Arg Phe Pro Lys Lys 290 295 300 Ala Ala Thr Val 305 81255PRTPseudomonas putida 81Met Ala Ala Glu Ser Tyr Arg Leu Gln Ala Leu Asp Pro Ser Arg Ala 1 5 10 15 Trp His Arg Phe Phe Ala Thr Val Gln Gln Gln Val Glu Lys Arg Ala 20 25 30 Phe Gly Asp Asp Ser Ser Glu His Cys Leu Arg Asn Ala Gln Gln Glu 35 40 45 Leu Thr Met Leu Gly Val Thr Asp Tyr Gly Ala Phe Val Ile Ala Phe 50 55 60 Leu Ile Leu Leu Ala Ile Pro Gly Pro Gly Asn Phe Ala Leu Ile Thr 65 70 75 80 Ala Thr Gly Lys Gly Gly Ile Lys Ala Gly Leu Ala Ala Thr Cys Gly 85 90 95 Val Ile Val Gly Asp Gln Val Leu Leu Trp Leu Ala Val Ala Gly Val 100 105 110 Ala Thr Leu Leu Ala Thr Tyr Pro Ala Ala Phe His Met Val Gln Trp 115 120 125 Ala Gly Ala Ala Tyr Leu Ala Tyr Leu Gly Leu Arg Met Leu Leu Ser 130 135 140 Lys Pro Gly Gly Ala Ala His Thr Cys Arg Met Asp Asn Gly Gln Tyr 145 150 155 160 Leu Arg Gln Thr Met Met Ile Thr Leu Leu Asn Pro Lys Ala Ile Met 165 170 175 Phe Tyr Met Ala Phe Phe Pro Leu Phe Val Asp Pro Val Lys His Gln 180 185 190 Gly Leu Val Thr Phe Gly Phe Met Ala Ala Thr Val Ala Val Val Thr 195 200 205 Phe Leu Tyr Gly Leu Ile Ala Val Val Leu Thr His Gln Leu Ala Glu 210 215 220 Arg Met Arg Ala Ser Pro Arg Ile Ala Asn Met Phe Glu Arg Leu Ala 225 230 235 240 Gly Ala Cys Leu Val Gly Phe Gly Ile Lys Leu Ala Ala Met Arg 245 250 255 82232PRTPseudomonas putida 82Met Gln Gln Gln Val Glu Lys Arg Ala Phe Gly Asp Asp Ser Ser Ala 1 5 10 15 His Cys Leu Arg Asn Ala Gln Gln Glu Leu Thr Met Leu Gly Val Thr 20 25 30 Asp Tyr Gly Ala Phe Val Ile Ala Phe Leu Ile Leu Leu Ala Ile Pro 35 40 45 Gly Pro Gly Asn Phe Ala Leu Ile Thr Ala Thr Gly Lys Gly Gly Ile 50 55 60 Lys Ala Gly Leu Ala Ala Thr Cys Gly Val Ile Val Gly Asp Gln Val 65 70 75 80 Leu Leu Trp Leu Ala Val Ala Gly Val Ala Thr Leu Leu Ala Thr Tyr 85 90 95 Pro Ala Ala Phe His Val Val Gln Trp Ala Gly Ala Ala Tyr Leu Ala 100 105 110 Tyr Leu Gly Leu Arg Met Leu Leu Ser Lys Pro Gly Gly Ala Ala His 115 120 125 Thr Cys Arg Met Asp Asn Gly Gln Tyr Leu Arg Gln Thr Met Met Ile 130 135 140 Thr Leu Leu Asn Pro Lys Ala Ile Met Phe Tyr Met Ala Phe Phe Pro 145 150 155

160 Leu Phe Val Asp Pro Val Lys His Gln Gly Leu Val Thr Phe Gly Phe 165 170 175 Met Ala Ala Thr Val Ala Val Val Thr Phe Leu Tyr Gly Leu Ile Ala 180 185 190 Val Val Leu Thr His Gln Leu Ala Glu Arg Met Arg Ala Ser Pro Arg 195 200 205 Ile Ala Asn Met Phe Glu Arg Leu Ala Gly Ala Cys Leu Val Gly Phe 210 215 220 Gly Ile Lys Leu Ala Ala Met Arg 225 230 83232PRTPseudomonas putida 83Met Gln Gln Gln Val Glu Lys Arg Ala Val Gly Asp Asp Ser Ser Ala 1 5 10 15 His Cys Leu Arg Asn Ala Gln Gln Glu Leu Thr Met Leu Gly Val Thr 20 25 30 Asp Tyr Gly Ala Phe Val Ile Ala Phe Leu Ile Leu Leu Ala Ile Pro 35 40 45 Gly Pro Gly Asn Phe Ala Leu Ile Thr Ala Thr Gly Lys Gly Gly Ile 50 55 60 Lys Ala Gly Leu Ala Ala Thr Cys Gly Val Ile Val Gly Asp Gln Val 65 70 75 80 Leu Leu Trp Leu Ala Val Ala Gly Val Ala Thr Leu Leu Ala Thr Tyr 85 90 95 Pro Ala Ala Phe His Met Val Gln Trp Ala Gly Ala Ala Tyr Leu Ala 100 105 110 Tyr Leu Gly Leu Arg Met Leu Leu Ser Lys Pro Gly Gly Ala Ala His 115 120 125 Thr Cys Arg Met Asp Asn Gly Gln Tyr Leu Arg Gln Thr Met Met Ile 130 135 140 Thr Leu Leu Asn Pro Lys Ala Ile Met Phe Tyr Met Ala Phe Phe Pro 145 150 155 160 Leu Phe Val Asp Pro Val Lys His Gln Gly Leu Val Thr Phe Gly Phe 165 170 175 Met Ala Ala Thr Val Ala Val Val Thr Phe Leu Tyr Gly Leu Ile Ala 180 185 190 Val Val Leu Thr His Gln Leu Ala Glu Arg Met Arg Ala Asn Pro Arg 195 200 205 Ile Ala Asn Met Phe Glu Arg Leu Ala Gly Ala Cys Leu Val Gly Phe 210 215 220 Gly Ile Lys Leu Ala Ala Met Arg 225 230 84205PRTPseudomonas putida 84Met Leu Gly Val Thr Asp Tyr Gly Ala Phe Val Ile Ala Phe Leu Ile 1 5 10 15 Leu Leu Ala Ile Pro Gly Pro Gly Asn Phe Ala Leu Ile Thr Ala Thr 20 25 30 Gly Lys Gly Gly Ile Lys Ala Gly Leu Ala Ala Thr Cys Gly Val Ile 35 40 45 Val Gly Asp Gln Val Leu Leu Trp Leu Ala Val Ala Gly Val Ala Thr 50 55 60 Leu Leu Ala Thr Tyr Pro Ala Ala Phe His Met Val Gln Trp Ala Gly 65 70 75 80 Ala Ala Tyr Leu Ala Tyr Leu Gly Leu Arg Met Leu Leu Ser Lys Pro 85 90 95 Gly Gly Ala Ala His Thr Cys Arg Met Asp Asn Gly Gln Tyr Leu Arg 100 105 110 Gln Thr Met Met Ile Thr Leu Leu Asn Pro Lys Ala Ile Met Phe Tyr 115 120 125 Met Ala Phe Phe Pro Leu Phe Val Asp Pro Val Lys His Gln Gly Leu 130 135 140 Val Thr Phe Gly Phe Met Ala Ala Thr Val Ala Val Val Thr Phe Leu 145 150 155 160 Tyr Gly Leu Ile Ala Val Val Leu Thr His Gln Leu Ala Glu Arg Met 165 170 175 Arg Ala Asn Pro Arg Ile Ala Asn Met Phe Glu Arg Leu Ala Gly Ala 180 185 190 Cys Leu Val Gly Phe Gly Ile Lys Leu Ala Ala Met Arg 195 200 205 85205PRTPseudomonas putida 85Met Leu Gly Val Thr Asp Tyr Gly Ala Phe Val Ile Ala Phe Ile Ile 1 5 10 15 Leu Leu Ala Ile Pro Gly Pro Gly Asn Phe Ala Leu Ile Thr Ala Thr 20 25 30 Gly Lys Gly Gly Ile Lys Ala Gly Leu Ala Ala Thr Cys Gly Val Ile 35 40 45 Val Gly Asp Gln Val Leu Leu Trp Leu Ala Val Ala Gly Val Ala Thr 50 55 60 Leu Leu Ala Thr Tyr Pro Ala Ala Phe His Ile Val Gln Trp Ala Gly 65 70 75 80 Ala Ala Tyr Leu Ala Tyr Leu Gly Leu Arg Met Leu Leu Ser Lys Pro 85 90 95 Gly Asp Ala Pro Arg Thr Ser Arg Met Asp Asn Gly Gln Tyr Leu Arg 100 105 110 Gln Thr Met Leu Ile Thr Leu Leu Asn Pro Lys Ala Ile Met Phe Tyr 115 120 125 Met Ala Phe Phe Pro Leu Phe Ile Asp Pro Val Lys His Gln Gly Leu 130 135 140 Val Thr Phe Gly Phe Met Ala Ala Thr Val Ala Val Ile Thr Phe Leu 145 150 155 160 Tyr Gly Leu Ile Ala Val Val Leu Thr His Arg Leu Ala Glu Arg Met 165 170 175 Arg Ala Asn Pro Arg Ile Thr Asn Met Phe Glu Arg Leu Ala Gly Ala 180 185 190 Cys Leu Val Gly Phe Gly Ile Lys Leu Ala Ala Met Arg 195 200 205 86296PRTPseudomonas putida 86Met Arg Pro Thr Glu Asn Gly Val Leu His Leu Arg Lys Lys Phe Val 1 5 10 15 Ala Ser Leu Leu Ala Val Ala Ile Ala Ser Thr Thr Ala Cys Ala Gln 20 25 30 Leu Gly Ile Ser Lys Glu Gln Ala Gly Thr Val Ile Gly Gly Leu Ala 35 40 45 Gly Val Ala Ile Gly Ser Thr Met Gly Ser Gly Asn Gly Lys Ile Ala 50 55 60 Ala Ala Leu Ile Ala Gly Gly Ile Gly Ala Tyr Val Gly Asn Arg Ile 65 70 75 80 Gly His Met Leu Asp Glu Lys Asp Gln Gln Ala Leu Ala Leu Arg Thr 85 90 95 Gln Glu Val Leu Ser Gln Gln Gln Thr Thr Ala Ser Ala Gln Pro Val 100 105 110 Thr Trp Lys Ser Asp His Ser Gly Ala Thr Ala Gln Ile Val Pro Gly 115 120 125 Lys Glu Tyr Thr Lys Thr Lys Gln Val Glu Val Lys Arg Ala Pro Lys 130 135 140 Ile Gln Ala Val Pro Ser Met Lys Leu Ile Asn Glu Pro Tyr Val Thr 145 150 155 160 Ile Ser Asp Asn Leu Asn Val Arg Ala Ala Pro Asn Gln Ala Gly Glu 165 170 175 Lys Val Gly Ser Leu Lys Asn His Thr Glu Phe Thr Ala Val Gly Ser 180 185 190 Thr Gly Asp Trp Ile Leu Val Gly Arg Lys Gly Val Thr Val Gly Tyr 195 200 205 Val His Lys Asn Tyr Val Glu Pro Lys Ala Gln Ala Val Ala Lys Arg 210 215 220 Val Thr Pro Ala Val Asn Leu Asp Glu Leu Asp Val Ala Ala Ser Lys 225 230 235 240 Glu Thr Gln Gly Phe Asp Leu Asp Ser Val Gln Ser Leu Pro Thr Gln 245 250 255 Thr Val Ala Ala Glu Ala Ala Cys Arg Pro Val Thr Val Ser Leu Lys 260 265 270 Ser Gln Ser Gly Gln Thr Glu Gln Glu Gln Asn Thr Phe Cys Lys Gln 275 280 285 Ala Asn Gly Thr Trp Glu Leu Ile 290 295 87285PRTPseudomonas putida 87Met Arg Lys Lys Phe Val Ala Ser Leu Leu Ala Val Ala Ile Ala Thr 1 5 10 15 Thr Thr Ala Cys Ala Gln Leu Gly Ile Ser Lys Glu Gln Ala Gly Thr 20 25 30 Val Ile Gly Gly Leu Ala Gly Val Ala Ile Gly Ser Thr Met Gly Ser 35 40 45 Gly Asn Gly Lys Ile Ala Ala Ala Leu Ile Ala Gly Gly Ile Gly Ala 50 55 60 Tyr Val Gly Asn Arg Ile Gly His Met Leu Asp Glu Lys Asp Gln Gln 65 70 75 80 Ala Leu Ala Leu Arg Thr Gln Glu Val Leu Ser Gln Ser Ala Thr Ala 85 90 95 Ser Ala Gln Pro Val Thr Trp Lys Ser Asp His Ser Gly Ala Thr Ala 100 105 110 Gln Ile Thr Pro Gly Lys Glu Tyr Thr Gln Thr Lys Lys Val Glu Val 115 120 125 Lys Arg Ala Pro Lys Ile Gln Ala Val Pro Ser Met Lys Leu Ile Asn 130 135 140 Glu Pro Tyr Val Thr Ile Ser Asp Asn Leu Asn Val Arg Ala Ala Pro 145 150 155 160 Asn Thr Thr Gly Glu Lys Val Gly Ser Leu Lys Ser His Thr Glu Phe 165 170 175 Thr Ala Val Gly Ser Thr Gly Asp Trp Ile Leu Val Gly Arg Lys Gly 180 185 190 Val Thr Val Gly Tyr Val His Lys Asn Tyr Val Glu Pro Lys Ala Gln 195 200 205 Ala Ile Ala Lys Arg Ala Ala Pro Ala Val Asn Leu Asp Asp Leu Asp 210 215 220 Val Ala Ala Asn Lys Glu Thr Gln Gly Phe Asp Leu Asp Ser Ile Gln 225 230 235 240 Ser Leu Pro Thr Glu Thr Val Ala Ala Glu Ala Ala Cys Arg Pro Val 245 250 255 Thr Val Ser Leu Lys Ser Gln Ser Gly Gln Thr Glu Gln Glu Gln Asn 260 265 270 Thr Phe Cys Lys Gln Ala Asn Gly Thr Trp Glu Leu Ile 275 280 285 88286PRTPseudomonas sp. TJI-51 88Met Arg Lys Lys Phe Val Ala Ser Leu Leu Ala Val Ala Ile Ala Ser 1 5 10 15 Thr Thr Ala Cys Ala Gln Leu Gly Ile Ser Lys Glu Gln Ala Gly Thr 20 25 30 Val Ile Gly Gly Leu Ala Gly Val Ala Ile Gly Ser Thr Leu Gly Ser 35 40 45 Gly Asn Gly Lys Ile Ala Ala Ala Leu Ile Ala Gly Gly Ile Gly Ala 50 55 60 Tyr Val Gly Asn Arg Ile Gly Asn Met Leu Asp Glu Lys Asp Gln Gln 65 70 75 80 Ala Leu Ala Leu Arg Thr Gln Glu Val Leu Ser Gln Gln Gln Ala Thr 85 90 95 Ala Ser Ala Gln Pro Val Thr Trp Lys Ser Asp His Ser Gly Ala Ser 100 105 110 Ala Gln Ile Val Pro Gly Lys Glu Tyr Thr Lys Thr Lys Gln Val Glu 115 120 125 Val Lys Arg Ala Pro Lys Ile Gln Ala Val Pro Ser Met Lys Leu Ile 130 135 140 Asn Glu Pro Tyr Val Thr Thr Ser Asp Asn Leu Asn Val Arg Ala Ala 145 150 155 160 Pro Asn Ala Ser Gly Glu Lys Val Gly Ser Leu Lys Asn His Thr Glu 165 170 175 Phe Thr Ala Val Gly Ala Thr Gly Asp Trp Ile Leu Val Gly Arg Lys 180 185 190 Gly Val Thr Val Gly Tyr Val His Lys Asp Tyr Val Glu Pro Lys Ala 195 200 205 Gln Ala Val Ala Lys Arg Val Thr Pro Ala Val Asn Leu Asp Glu Leu 210 215 220 Asp Val Ala Ala Ser Lys Glu Thr Gln Ala Phe Asp Leu Asp Ser Leu 225 230 235 240 Gln Ser Leu Pro Thr Gln Thr Val Ala Ala Glu Ala Ala Cys Arg Pro 245 250 255 Val Thr Val Ser Leu Lys Ala Gln Asn Gly Lys Thr Glu Gln Glu Gln 260 265 270 Asn Thr Phe Cys Lys Gln Ala Asn Gly Thr Trp Glu Leu Ile 275 280 285 89286PRTPseudomonas putida 89Met Arg Lys Lys Phe Val Ala Ser Leu Leu Ala Val Ala Ile Ala Ser 1 5 10 15 Thr Thr Ala Cys Ala Gln Leu Gly Ile Ser Lys Glu Gln Ala Gly Thr 20 25 30 Val Ile Gly Gly Leu Ala Gly Val Ala Ile Gly Ser Thr Met Gly Ser 35 40 45 Gly Asn Gly Lys Ile Ala Ala Ala Leu Ile Ala Gly Gly Ile Gly Ala 50 55 60 Tyr Val Gly Asn Arg Ile Gly His Met Leu Asp Glu Lys Asp Gln Gln 65 70 75 80 Ala Leu Ala Leu Arg Thr Gln Glu Val Leu Ser Gln Gln Gln Ala Thr 85 90 95 Ala Ser Ala Gln Pro Val Thr Trp Lys Ser Asp His Ser Gly Ala Thr 100 105 110 Ala Gln Ile Val Pro Gly Lys Glu Tyr Thr Gln Thr Lys Lys Val Glu 115 120 125 Val Lys Arg Ala Pro Lys Ile Gln Ala Val Pro Ser Met Lys Leu Ile 130 135 140 Asn Glu Pro Tyr Val Thr Val Ser Asp Asn Leu Asn Val Arg Ala Ala 145 150 155 160 Pro Asn Gln Ser Gly Glu Lys Val Gly Ser Leu Lys Asn His Thr Glu 165 170 175 Phe Thr Ala Val Gly Ser Thr Gly Asp Trp Ile Leu Val Gly Arg Lys 180 185 190 Gly Val Thr Val Gly Tyr Val His Lys Asn Tyr Val Glu Pro Lys Ala 195 200 205 Gln Ala Val Ala Lys Arg Val Thr Pro Ala Val Asn Leu Asp Glu Leu 210 215 220 Asp Val Ala Ala Ser Lys Glu Thr Gln Gly Phe Asp Leu Asp Ser Val 225 230 235 240 Gln Ser Leu Pro Thr Glu Thr Val Ala Ala Glu Ala Ala Cys Arg Pro 245 250 255 Val Thr Val Ser Leu Lys Ser Gln Ser Gly Gln Thr Glu Gln Glu Gln 260 265 270 Asn Thr Phe Cys Lys Gln Ala Asn Gly Thr Trp Glu Leu Ile 275 280 285 90286PRTPseudomonas putida 90Met Arg Lys Lys Phe Val Ala Ser Leu Leu Ala Val Ala Ile Ala Ser 1 5 10 15 Thr Thr Ala Cys Ala Gln Leu Gly Ile Ser Lys Glu Gln Ala Gly Thr 20 25 30 Val Ile Gly Gly Leu Ala Gly Val Ala Ile Gly Ser Thr Met Gly Ser 35 40 45 Gly Asn Gly Lys Ile Ala Ala Ala Leu Ile Ala Gly Gly Ile Gly Ala 50 55 60 Tyr Val Gly Asn Arg Ile Gly His Met Leu Asp Glu Lys Asp Gln Gln 65 70 75 80 Ala Leu Ala Leu Arg Thr Gln Glu Val Leu Ser Gln Gln Gln Thr Thr 85 90 95 Ala Ser Ala Gln Pro Val Thr Trp Lys Ser Asp His Ser Gly Ala Thr 100 105 110 Ala Gln Ile Val Pro Gly Lys Glu Tyr Thr Lys Thr Lys Gln Val Glu 115 120 125 Val Lys Arg Ala Pro Lys Ile Gln Ala Val Pro Ser Met Lys Leu Ile 130 135 140 Asn Glu Pro Tyr Val Thr Ile Ser Asp Asn Leu Asn Val Arg Ala Ala 145 150 155 160 Pro Asn Gln Ala Gly Glu Lys Val Gly Ser Leu Lys Asn His Thr Glu 165 170 175 Phe Thr Ala Val Gly Ser Thr Gly Asp Trp Ile Leu Val Gly Arg Lys 180 185 190 Gly Val Thr Val Gly Tyr Val His Lys Asn Tyr Val Glu Pro Lys Ala 195 200 205 Gln Ala Val Ala Lys Arg Val Thr Pro Ala Val Asn Leu Asp Glu Leu 210 215 220 Asp Val Ala Ala Ser Lys Glu Thr Gln Gly Phe Asp Leu Asp Ser Val 225 230 235 240 Gln Ser Leu Pro Thr Gln Thr Val Ala Ala Glu Ala Ala Cys Arg Pro 245 250 255 Val Thr Val Ser Leu Lys Ser Gln Ser Gly Gln Thr Glu Gln Glu Gln 260 265 270 Asn Thr Phe Cys Lys Gln Ala Asn Gly Thr Trp Glu Leu Ile 275 280 285 91487PRTPseudomonas putida 91Met Pro Ile Cys Ser Ser Gly Trp Arg Gly Leu Ala Trp Trp Asp Ser 1 5 10 15 Ala Ser Asn Trp Arg Arg Cys Ala Asp Pro Lys Pro Asp Ser Val Arg 20 25 30 Ala Arg Leu Thr Ala Thr Leu Lys Lys Pro Pro Ala Thr His Gly Ser 35 40 45 Arg Gly Leu Val His Ser Ala Ile Thr Gln Ser Ile Gly Phe Gln Leu 50 55 60 Ile Gly Leu Ala His Glu Gln Arg Arg Lys Gln Ala Leu Ala Phe Leu 65 70 75 80 Glu Gly Val Leu Leu Phe Glu Arg Ala Val Phe Asp Gln Leu Leu Pro 85 90 95 Asp Gly Ala Phe Arg Val Ala Val Val Leu Gly Leu Gly Ala Lys Val 100 105 110 Thr Ala Pro Arg Arg Gln Pro Asn Leu Leu Ala Glu Gly

Cys Glu Leu 115 120 125 Cys Leu Gly Asp Leu Leu Leu Val Phe Ala Glu Ser Leu Phe Gln Arg 130 135 140 Phe Glu Ala Ala Val Ala His Arg Val Val Leu Asp Leu Gly Leu Ala 145 150 155 160 Gly Lys Ala Ala His Arg Phe Ser Gln His Arg Leu Ala Gly Val Arg 165 170 175 Ala Val Arg Ala Asn Gln His Arg Ala Gln Gly Thr Leu Glu Leu Gly 180 185 190 Phe Asp Ile Val Gln Phe Arg Gln Arg Leu Glu Val Gly Leu Ala His 195 200 205 Asp Phe Pro His Leu Gly Ala Val Val Ala Val Gly Asp His Glu Arg 210 215 220 His Arg Ala Phe Ala Ile Ala Gly Ala Leu Asp Gly Glu Val Gln Val 225 230 235 240 Asp Arg Gly Thr Lys Val Thr Gly Ala Ala Asp Gln Lys Arg Ala Gly 245 250 255 Tyr Trp Leu Ala His Arg His Val Gly Ala Pro Gly Glu Val Arg Arg 260 265 270 Gly Gly Pro Thr Ile Gly Gly Gln Leu Gly Thr Trp Leu Asp Phe Val 275 280 285 Ala Asp Ile Arg His Gln His Asp Phe Gly Pro Leu Gly Gly Asn Val 290 295 300 Arg Val Ala His Leu His Ala Gln Gln Leu Asp Met Asn Ala Ala Ile 305 310 315 320 Leu Ala Val Ser Val Met Gly Gln Leu Gln Arg Ile Ser Leu Gln Val 325 330 335 His Pro Gly His Ile Ala Ala Asp Ile Glu Leu Val Leu Gly Pro Ala 340 345 350 Arg Gln Ala Phe Phe Ser Arg Thr Thr Leu Tyr Gly Leu His Gln Ala 355 360 365 Arg Gln Ala Ala His Glu Leu Leu Gly Ala Ile Gly Leu Arg Arg Arg 370 375 380 His Ala Asp Leu Arg Val Gly Tyr Arg Gln Val Ala Gly Lys Arg Arg 385 390 395 400 Val Gly Asn Val Pro Leu Arg Gln His Ile Leu Lys Glu Ile Ala Leu 405 410 415 Leu Glu Val Val Val Val Gly Gln Arg Ser Leu Leu Ala Arg Ala Gly 420 425 430 Asp His Arg Ile Ala Thr Thr Glu His Gln His Arg Cys Gly His Thr 435 440 445 Ala Asn Gln Gln Leu Leu Leu Val His Leu Phe Asp His Gly Val Cys 450 455 460 Leu Thr Gly Pro Trp Arg Lys Arg Cys Ser Ser Arg Ser Arg Thr Val 465 470 475 480 Gly Arg Pro Arg Gly Ser Ser 485 92577PRTGlycine max 92Met Ser Asn Ile Ala Phe Arg Ser Thr Ile Val Phe Leu Leu Phe Ser 1 5 10 15 Ala Val Leu Ser Thr Pro Pro Glu Asp Pro Ile Lys Cys Ala Thr Ser 20 25 30 Glu Asn Thr Thr Cys Thr Ile Thr Asn Ser Tyr Gly Ala Phe Pro Asp 35 40 45 Arg Ser Ile Cys Lys Ala Ala Gln Val Leu Tyr Pro Thr Thr Glu Gln 50 55 60 Glu Leu Val Ser Val Val Ala Ser Ala Thr Arg Asn Lys Thr Lys Met 65 70 75 80 Lys Val Ala Thr Arg Phe Ser His Ser Ile Pro Lys Leu Val Cys Pro 85 90 95 Glu Gly Glu Asn Gly Leu Leu Ile Ser Thr Lys Tyr Leu Asn Lys Ile 100 105 110 Leu Lys Val Asp Val Glu Thr Arg Thr Met Thr Val Glu Ser Gly Val 115 120 125 Thr Leu Gln Gln Leu Ile Asn Glu Ala Ala Lys Val Gly Leu Ala Leu 130 135 140 Pro Tyr Ala Pro Tyr Trp Trp Gly Leu Thr Ile Gly Gly Leu Met Gly 145 150 155 160 Thr Gly Ala His Gly Ser Thr Leu Arg Gly Lys Gly Ser Ala Val His 165 170 175 Asp Tyr Val Val Glu Leu Arg Ile Val Arg Pro Ala Gly Pro Glu Asp 180 185 190 Gly Tyr Ala Met Val Glu Asn Leu Asn Glu Gln His Glu Asp Leu Asn 195 200 205 Ala Ala Lys Val Ser Leu Gly Val Leu Gly Val Ile Ser Gln Ile Thr 210 215 220 Leu Lys Leu Glu Pro Leu Phe Lys Arg Ser Ile Thr Tyr Val Ala Lys 225 230 235 240 Asp Asp Ser Asp Leu Gly Gly Gln Val Val Ala Phe Gly Asp Ala His 245 250 255 Glu Phe Ala Asp Ile Thr Trp Tyr Pro Ser Gln His Lys Ala Ile Tyr 260 265 270 Arg Val Asp Asp Arg Val Pro Ile Asn Thr Ser Gly Asn Gly Leu Tyr 275 280 285 Asp Phe Ile Pro Phe Arg Pro Thr Pro Ser Leu Ala Ser Val Phe Ile 290 295 300 Arg Thr Thr Glu Glu Ile Gln Glu Ser Thr Asn Asp Ala Asn Gly Lys 305 310 315 320 Cys Ile Val Ala Ser Thr Ala Ser Asn Thr Leu Ile Thr Ala Ala Tyr 325 330 335 Gly Leu Thr Asn Asn Gly Ile Ile Phe Ala Gly Tyr Pro Ile Ile Gly 340 345 350 Phe Gln Asn Arg Leu Gln Ser Ser Gly Ser Cys Leu Asp Ser Leu Gln 355 360 365 Asp Ala Leu Ile Thr Thr Cys Ala Trp Asp Pro Arg Met Lys Gly Leu 370 375 380 Phe Phe His Gln Thr Thr Phe Ser Ile Arg Leu Ser Phe Val Lys Ser 385 390 395 400 Phe Ile Glu Asp Val Gln Lys Leu Val Glu Leu Glu Pro Lys Gly Leu 405 410 415 Cys Val Leu Gly Leu Tyr Asn Gly Met Leu Met Arg Tyr Val Thr Ala 420 425 430 Ser Ser Ala Tyr Leu Gly His Gln Glu Asn Ala Leu Asp Ile Asp Ile 435 440 445 Thr Tyr Tyr Arg Ser Lys Asp Pro Met Thr Pro Arg Leu Tyr Glu Asp 450 455 460 Ile Leu Glu Glu Val Glu Gln Leu Gly Ile Phe Lys Tyr Gly Gly Leu 465 470 475 480 Pro His Trp Gly Lys Asn Arg Asn Leu Ala Phe Glu Gly Ala Ile Lys 485 490 495 Lys Tyr Lys Ser Ala Glu Tyr Phe Leu Lys Val Lys Glu Lys Tyr Asp 500 505 510 Leu Asp Gly Leu Phe Ser Ser Thr Trp Thr Asp Gln Val Leu Gly Leu 515 520 525 Lys Asp Gly Val Thr Ile Leu Lys Asp Gly Cys Ala Leu Glu Gly Leu 530 535 540 Cys Ile Cys Leu Gln Asp Ser His Cys Asn Pro Ser Lys Gly Tyr Tyr 545 550 555 560 Cys Arg Pro Gly Lys Val Tyr Lys Glu Ala Arg Val Cys Thr Asn Leu 565 570 575 Lys 93619PRTPseudomonas putida 93Met Lys Lys His Ala Leu Ala Leu Ala Val Ile Gly Ala Cys Gly Leu 1 5 10 15 Val Pro Gln Ala Phe Ala His Glu Leu Ala Phe Ser Lys Lys Asp Asn 20 25 30 Ile Lys Val Glu Val Pro Gly Asp Ala Thr Ser Trp Cys Lys Pro Gln 35 40 45 Val Asp Leu Thr Ile Thr Arg Pro Ala Trp Asp Asn Gln Glu Leu Leu 50 55 60 Ala Gly Leu Leu Thr Lys Leu Pro Phe Val Phe Ala Lys Asp Cys Ser 65 70 75 80 Thr Ala Lys Val Ser Trp Lys Ala Val Asp Ala Lys Gly Asn Leu Tyr 85 90 95 Ala Ser Gly Ser Gly Asn Ala Ser Asn Leu Gly Leu Val Thr Leu Ala 100 105 110 Ala Ala Pro Ala Thr Ala Ala Pro Ala Pro Ala Ala Ala Pro Thr Pro 115 120 125 Thr Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Ala Ala Ala 130 135 140 Ala Pro Ala Val Val Glu Ala Ala Pro Ala Gln Ala Lys Pro Ala Pro 145 150 155 160 Ala Pro Ala Pro Ala Pro Ala Pro Ala Val Ala Ala Glu Pro Ala Pro 165 170 175 Ala Pro Glu Ala Pro Ala Ala Ala Pro Val Val Pro Pro Ala Pro Ala 180 185 190 Pro Ala Thr Ala Val Ala Ala Ala Pro Thr Ser Asp Phe Gly Arg Ser 195 200 205 Val Val Leu Glu Asn Arg Asn Leu Met Gln Val Thr Asp Gly Thr Gly 210 215 220 Cys Lys Trp Val Leu Ser Thr Ser Ile Ile Gly Asp Gly Asp Thr Leu 225 230 235 240 Ser Phe Gly Thr Thr Pro Ala Met Pro Cys Pro Ala Ser Gly Phe Gly 245 250 255 Glu Gly Ser Phe Asp Lys Ile Ser Trp Lys Ala Val Gly Thr Tyr Arg 260 265 270 Gly Asp Asn Trp Thr Arg Val Tyr Ala His Pro Ser Gly Leu Ile Phe 275 280 285 Asn Lys Asn Leu Glu Pro Ala Val Lys Asp Lys Ala Val Ser Tyr Leu 290 295 300 Thr Pro Gln Ala Asp Gln Ala Ala Phe Leu Val Gly Glu Ile Pro Gly 305 310 315 320 Arg Gln Met Lys Val Tyr Leu Thr Phe Thr Arg Ser Ser Tyr Gly Val 325 330 335 Leu Arg Pro Phe Ser Ser Asp Pro Tyr Tyr Val Ala Val Thr Pro Asp 340 345 350 Glu Ser Phe Ala Leu Asp Ala Thr Lys Tyr Lys Glu Ala Ala Leu Glu 355 360 365 Ile Phe Asp Leu Ile Lys Thr Thr Ser Pro Thr Thr Thr Asp Val Ala 370 375 380 Asn Leu Phe Ile Val Lys Asp Leu Ser Ala Ile Ser Asn Asn Ile Trp 385 390 395 400 Gly Asn Asp Ala Gln Lys Ile Thr Arg Asn Arg Ile Gly Ile Asn Arg 405 410 415 Gln Gly Leu Phe Phe Asp Val Arg Asp Gly Ala Asn Trp Ala Val Gln 420 425 430 Arg Glu Gln Gln Arg Val Arg Glu Gln Arg Gln Arg Gln Gln Glu Leu 435 440 445 Ala Arg Val His Thr Arg Val Leu Glu Arg Tyr Gln Gln Leu Gln Asp 450 455 460 Gly Met Ser Asp Phe Lys Gly Arg Glu Thr Glu Ala Leu Ala Gln Met 465 470 475 480 Ala Gly Ile Lys Val Arg Phe Ala Ser Pro Leu Glu Gln Gln Asn Pro 485 490 495 Ala Thr Ser Ala Ser Val Val Pro Met Met Val His Val Thr Gly Lys 500 505 510 Lys Gly Asp Phe Tyr Ser Ile Asp Phe Pro Ser Asn Gly Arg Leu Val 515 520 525 Ala Asp Glu Glu Tyr Ser Glu Gly Trp Tyr Val Thr Gln Val Ala Asn 530 535 540 Ala Thr Pro Tyr Tyr Pro Leu Asp Asp Gly Arg Ala Val Pro Thr Tyr 545 550 555 560 Arg Ala Tyr Ser Ala Gly Glu Pro Glu Ala Cys Lys Gln Asp His Cys 565 570 575 Ala Asp Arg Val Ser Phe Gly Ala Val Leu Ala Lys Glu Phe Pro Asn 580 585 590 Ala Gly Ile Asp Phe Ser Trp Thr Pro Glu Val Ser Gln Gln Tyr Val 595 600 605 Asn Asp Trp Asn Asn Ala Ser Ala Met Val Gln 610 615 94411PRTPseudomonas putida 94Met Val Leu Glu Asn Arg Asn Leu Met Gln Val Thr Asp Gly Thr Gly 1 5 10 15 Cys Lys Trp Val Leu Ser Thr Ser Ile Ile Gly Asp Gly Asp Thr Leu 20 25 30 Ser Phe Gly Thr Thr Pro Ala Met Pro Cys Pro Ala Ser Gly Phe Gly 35 40 45 Glu Gly Ser Phe Asp Lys Ile Ser Trp Lys Ala Val Gly Thr Tyr Arg 50 55 60 Gly Asp Asn Trp Thr Arg Val Tyr Ala His Pro Ser Gly Leu Ile Phe 65 70 75 80 Asn Lys His Leu Glu Pro Ala Val Lys Asp Lys Ala Val Ser Tyr Leu 85 90 95 Thr Pro Gln Ala Asp Gln Ala Ala Phe Leu Val Gly Glu Ile Pro Gly 100 105 110 Arg Gln Met Lys Val Tyr Leu Thr Phe Thr Arg Ser Ser Tyr Gly Val 115 120 125 Leu Arg Pro Phe Gly Ser Asp Pro Tyr Tyr Val Ala Val Thr Pro Asp 130 135 140 Glu Ser Phe Ala Leu Asp Ala Thr Lys Tyr Lys Glu Ala Ala Leu Glu 145 150 155 160 Ile Phe Asp Leu Ile Lys Thr Thr Ser Pro Thr Thr Thr Asp Val Ala 165 170 175 Asn Leu Phe Ile Val Lys Asp Leu Ser Ala Ile Ser Asn Asn Ile Trp 180 185 190 Gly Asn Asp Ala Gln Lys Ile Thr Arg Asn Arg Ile Gly Ile Asn Arg 195 200 205 Gln Gly Leu Phe Phe Asp Val Arg Asp Gly Ala Asn Trp Ala Val Gln 210 215 220 Arg Glu Gln Gln Arg Val Arg Glu Gln Arg Gln Arg Gln Gln Glu Leu 225 230 235 240 Ala Arg Val His Thr Arg Val Leu Glu Arg Tyr Gln Gln Leu Gln Asp 245 250 255 Gly Met Ser Asp Phe Lys Gly Arg Glu Thr Glu Ala Leu Ala Gln Met 260 265 270 Ala Gly Ile Lys Val Arg Phe Ala Ser Pro Leu Glu Gln Gln Asn Pro 275 280 285 Ala Thr Ser Ala Ser Val Val Pro Met Met Val His Val Thr Gly Lys 290 295 300 Lys Gly Asp Phe Tyr Ser Ile Asp Phe Pro Ser Asn Gly Arg Leu Val 305 310 315 320 Ala Asp Glu Glu Tyr Ser Glu Gly Trp Tyr Val Thr Gln Val Ala Asn 325 330 335 Ala Thr Pro Tyr Tyr Pro Leu Asp Asp Gly Arg Ala Val Pro Thr Tyr 340 345 350 Arg Ala Tyr Ser Ala Gly Glu Pro Glu Ala Cys Lys Gln Asp His Cys 355 360 365 Ala Asp Arg Val Ser Phe Gly Ala Val Leu Ala Lys Glu Phe Pro Asn 370 375 380 Ala Gly Ile Asp Phe Ser Trp Thr Pro Glu Val Ser Gln Gln Tyr Val 385 390 395 400 Asn Asp Trp Asn Asn Ala Ser Ala Met Val Gln 405 410 95632PRTPseudomonas putida 95Met Lys Lys His Ala Leu Ala Leu Ala Val Ile Gly Ala Cys Gly Leu 1 5 10 15 Val Pro Gln Ala Phe Ala His Glu Leu Ala Phe Ser Lys Lys Asp Asn 20 25 30 Ile Lys Val Glu Val Pro Gly Asp Ala Thr Thr Trp Cys Lys Pro Gln 35 40 45 Val Asp Leu Thr Ile Thr Arg Pro Ala Trp Asp Asn Gln Glu Leu Leu 50 55 60 Ser Gly Leu Leu Thr Lys Leu Pro Phe Val Phe Ala Lys Asp Cys Ser 65 70 75 80 Thr Ala Lys Val Ser Trp Lys Ala Val Asp Ala Lys Gly Asn Leu Tyr 85 90 95 Ala Ser Gly Ser Gly Asn Ala Ser Asn Leu Gly Leu Val Thr Leu Ala 100 105 110 Ala Ala Pro Ala Thr Ala Ala Pro Ala Pro Ala Ala Ala Val Ala Pro 115 120 125 Ala Pro Ala Pro Ala Gln Pro Glu Ala Pro Ala Ala Ala Ala Pro Thr 130 135 140 Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Ala Ala Ala Ala 145 150 155 160 Pro Ala Val Val Glu Ala Ala Pro Ala Gln Ala Lys Pro Ala Pro Ala 165 170 175 Pro Ala Pro Ala Pro Ala Val Ala Ala Glu Pro Ala Pro Thr Pro Glu 180 185 190 Ala Pro Ala Ala Ala Pro Val Val Pro Pro Ala Pro Ala Pro Ala Thr 195 200 205 Ala Val Ala Ala Ala Pro Thr Ser Asp Phe Gly Arg Ser Val Val Leu 210 215 220 Glu Asn Arg Asn Leu Met Gln Val Thr Asp Gly Thr Gly Cys Lys Trp 225 230 235 240 Val Leu Ser Thr Ser Ile Ile Gly Asp Gly Asp Thr Leu Ser Phe Gly 245 250 255 Thr Thr Pro Ala Met Pro Cys Pro Ala Ser Gly Phe Gly Glu Gly Ser 260 265 270 Phe Asp Lys Ile Ser Trp Lys Ala Val Gly Thr Tyr Arg Gly Asp Asn 275 280 285 Trp Thr Arg Val Tyr Ala His Pro Ser Gly Leu Ile Phe Asn Lys His 290 295 300 Leu Glu Pro Ala Val Lys Asp Lys Ala Val Ser Tyr Leu Thr Pro Gln 305 310

315 320 Ala Asp Gln Ala Ala Phe Leu Val Gly Glu Ile Pro Gly Arg Gln Met 325 330 335 Lys Val Tyr Leu Thr Phe Thr Arg Ser Ser Tyr Gly Val Leu Arg Pro 340 345 350 Phe Gly Ser Asp Pro Tyr Tyr Val Ala Val Thr Pro Asp Glu Ser Phe 355 360 365 Ala Leu Asp Ala Thr Lys Tyr Lys Glu Ala Ala Leu Glu Ile Phe Asp 370 375 380 Leu Ile Lys Thr Thr Ser Pro Thr Thr Thr Asp Val Ala Asn Leu Phe 385 390 395 400 Ile Val Lys Asp Leu Ser Ala Ile Ser Asn Asn Ile Trp Gly Asn Asp 405 410 415 Ala Gln Lys Ile Thr Arg Asn Arg Ile Gly Ile Asn Arg Gln Gly Leu 420 425 430 Phe Phe Asp Val Arg Asp Gly Ala Asn Trp Ala Val Gln Arg Glu Gln 435 440 445 Gln Arg Val Arg Glu Gln Arg Gln Arg Gln Gln Glu Leu Ala Arg Val 450 455 460 His Thr Arg Val Leu Glu Arg Tyr Gln Gln Leu Gln Asp Gly Met Ser 465 470 475 480 Asp Phe Lys Gly Arg Glu Thr Glu Ala Leu Ala Gln Met Ala Gly Ile 485 490 495 Lys Val Arg Phe Ala Ser Pro Leu Glu Gln Gln Asn Pro Ala Thr Ser 500 505 510 Ala Ser Val Val Pro Met Met Val His Val Thr Gly Lys Lys Gly Asp 515 520 525 Phe Tyr Ser Ile Asp Phe Pro Ser Asn Gly Arg Leu Val Ala Asp Glu 530 535 540 Glu Tyr Ser Glu Gly Trp Tyr Val Thr Gln Val Ala Asn Ala Thr Pro 545 550 555 560 Tyr Tyr Pro Leu Asp Asp Gly Arg Ala Val Pro Thr Tyr Arg Ala Tyr 565 570 575 Ser Ala Gly Glu Pro Glu Ala Cys Lys Gln Asp His Cys Ala Asp Arg 580 585 590 Val Ser Phe Gly Ala Val Leu Ala Lys Glu Phe Pro Asn Ala Gly Ile 595 600 605 Asp Phe Ser Trp Thr Pro Glu Val Ser Gln Gln Tyr Val Asn Asp Trp 610 615 620 Asn Asn Ala Ser Ala Met Val Gln 625 630 96642PRTPseudomonas putida 96Met Lys Lys His Ala Leu Ala Leu Ala Val Ile Gly Ala Cys Gly Leu 1 5 10 15 Val Pro Gln Ala Phe Ala His Glu Leu Ala Phe Ser Lys Lys Asp Asn 20 25 30 Ile Lys Val Glu Val Pro Gly Asp Ala Thr Thr Trp Cys Lys Pro Gln 35 40 45 Val Asp Leu Thr Ile Thr Arg Pro Ala Trp Asp Asn Gln Glu Leu Leu 50 55 60 Ser Gly Leu Leu Thr Lys Leu Pro Phe Val Phe Ala Lys Asp Cys Ser 65 70 75 80 Thr Ala Lys Val Ser Trp Lys Ala Val Asp Ala Lys Gly Asn Leu Tyr 85 90 95 Ala Ser Gly Ser Gly Asn Ala Ser Asn Leu Gly Leu Val Thr Leu Ala 100 105 110 Ala Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala 115 120 125 Ala Ala Ala Pro Ala Pro Ala Ala Ala Val Ala Pro Ala Pro Ala Pro 130 135 140 Ala Gln Pro Glu Ala Pro Ala Ala Ala Ala Pro Thr Pro Ala Pro Ala 145 150 155 160 Pro Ala Pro Ala Pro Ala Ala Ala Ala Ala Pro Ala Val Val Glu Ala 165 170 175 Ala Ala Ala Gln Ala Lys Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala 180 185 190 Val Ala Ala Glu Pro Ala Pro Thr Pro Glu Ala Pro Ala Ala Ala Pro 195 200 205 Val Val Pro Pro Ala Pro Ala Pro Ala Thr Ala Val Ala Ala Ala Pro 210 215 220 Thr Ser Asp Phe Gly Arg Ser Val Val Leu Glu Asn Arg Asn Leu Met 225 230 235 240 Gln Val Thr Asp Gly Thr Gly Cys Lys Trp Val Leu Ser Thr Ser Ile 245 250 255 Ile Gly Asp Gly Asp Thr Leu Ser Phe Gly Thr Thr Pro Ala Met Pro 260 265 270 Cys Pro Ala Ser Gly Phe Gly Glu Gly Ser Phe Asp Lys Ile Ser Trp 275 280 285 Lys Ala Val Gly Thr Tyr Arg Gly Asp Asn Trp Thr Arg Val Tyr Ala 290 295 300 His Pro Ser Gly Leu Ile Phe Asn Lys Asn Leu Glu Pro Ala Val Lys 305 310 315 320 Asp Lys Ala Val Ser Tyr Leu Thr Pro Gln Ala Asp Gln Ala Ala Phe 325 330 335 Leu Val Gly Glu Ile Pro Gly Arg Gln Met Lys Val Tyr Leu Thr Phe 340 345 350 Thr Arg Ser Ser Tyr Gly Val Leu Arg Pro Phe Gly Ser Asp Pro Tyr 355 360 365 Tyr Val Ala Val Thr Pro Asp Glu Ser Phe Ala Leu Asp Ala Thr Lys 370 375 380 Tyr Lys Glu Ala Ala Leu Glu Ile Phe Asp Leu Ile Lys Thr Thr Ser 385 390 395 400 Pro Thr Thr Thr Asp Val Ala Asn Leu Phe Ile Val Lys Asp Leu Ser 405 410 415 Ala Ile Ser Asn Asn Ile Trp Gly Asn Asp Ala Gln Lys Ile Thr Arg 420 425 430 Asn Arg Ile Gly Ile Asn Arg Gln Gly Leu Phe Phe Asp Val Arg Asp 435 440 445 Gly Ala Asn Trp Ala Val Gln Arg Glu Gln Gln Arg Val Arg Glu Gln 450 455 460 Arg Gln Arg Gln Gln Glu Leu Ala Arg Val His Thr Arg Val Leu Glu 465 470 475 480 Arg Tyr Gln Gln Leu Gln Asp Gly Met Ser Asp Phe Lys Gly Arg Glu 485 490 495 Thr Glu Ala Leu Ala Gln Met Ala Gly Ile Lys Val Arg Phe Ala Ser 500 505 510 Pro Leu Glu Gln Gln Asn Pro Ala Thr Ser Ala Ser Val Val Pro Met 515 520 525 Met Val His Val Thr Gly Lys Lys Gly Asp Phe Tyr Ser Ile Asp Phe 530 535 540 Pro Ser Asn Gly Arg Leu Val Ala Asp Glu Glu Tyr Ser Glu Gly Trp 545 550 555 560 Tyr Val Thr Gln Val Ala Asn Ala Thr Pro Tyr Tyr Pro Leu Asp Asp 565 570 575 Gly Arg Ala Val Pro Thr Tyr Arg Ala Tyr Ser Ala Gly Glu Pro Glu 580 585 590 Ala Cys Lys Gln Asp His Cys Ala Asp Arg Val Ser Phe Gly Ala Val 595 600 605 Leu Ala Lys Glu Phe Pro Asn Ala Gly Ile Asp Phe Ser Trp Thr Pro 610 615 620 Glu Val Ser Gln Gln Tyr Val Asn Asp Trp Asn Asn Ala Ser Ala Met 625 630 635 640 Val Gln 97637PRTPseudomonas putida 97Met Lys Lys His Ala Leu Ala Leu Ala Val Val Gly Ala Cys Gly Leu 1 5 10 15 Val Pro Gln Ala Phe Ala His Glu Leu Ala Phe Ser Lys Lys Glu Asn 20 25 30 Ile Lys Val Glu Val Pro Gly Asp Ala Ala Thr Trp Cys Lys Pro Glu 35 40 45 Val Glu Leu Thr Ile Thr Arg Pro Ala Trp Asp Lys Gln Glu Leu Leu 50 55 60 Ser Gly Leu Leu Thr Lys Leu Pro Phe Val Phe Ala Lys Asp Cys Ala 65 70 75 80 Thr Ala Lys Val Ser Trp Lys Ala Val Asp Ala Lys Gly Asn Leu Tyr 85 90 95 Ala Ser Gly Ser Gly Asn Ala Thr Asn Leu Gly Leu Val Thr Leu Ala 100 105 110 Val Ala Pro Ala Ala Ala Ser Ala Ala Pro Ala Pro Ala Pro Ala Pro 115 120 125 Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Pro Ala Val Ala Ala 130 135 140 Leu Ala Pro Ala Ala Pro Ala Val Pro Ala Pro Ala Glu Ala Pro Ala 145 150 155 160 Ala Val Ala Ala Ala Pro Ala Pro Ala Val Val Glu Pro Ala Pro Ala 165 170 175 Lys Ala Glu Val Ala Pro Ala Pro Val Val Ala Ala Glu Pro Ala Pro 180 185 190 Ala Pro Val Ala Glu Thr Pro Val Ala Ala Pro Val Ala Pro Pro Val 195 200 205 Pro Ala Pro Ala Asp Ala Val Ala Ala Ala Pro Thr Ser Asp Phe Gly 210 215 220 Arg Ala Val Val Leu Gln Asn Arg Asn Leu Met Gln Val Thr Asp Gly 225 230 235 240 Thr Gly Cys Lys Trp Val Leu Ser Thr Ser Ile Ile Ser Asp Gly Asp 245 250 255 Thr Leu Ser Phe Gly Thr Thr Pro Val Met Pro Cys Pro Ala Ser Gly 260 265 270 Phe Gly Glu Gly Ser Phe Glu Lys Ile Ser Trp Lys Ala Val Gly Thr 275 280 285 Tyr Arg Gly Asp Asn Trp Thr Arg Val Tyr Ala His Pro Ser Gly Leu 290 295 300 Ile Phe Asn Lys Asn Leu Glu Ser Ala Val Lys Asp Lys Ala Val Ser 305 310 315 320 Tyr Leu Thr Ala Asp Ala Asp Gln Ala Ala Phe Leu Val Gly Glu Ile 325 330 335 Pro Ser Arg Gln Met Lys Val Tyr Leu Thr Phe Thr Arg Ser Ser Tyr 340 345 350 Gly Val Leu Arg Pro Phe Ser Ser Asp Pro Tyr Tyr Val Ala Val Thr 355 360 365 Pro Asp Glu Ser Phe Ala Leu Asp Ala Ala Lys Tyr Lys Glu Ala Ala 370 375 380 Leu Glu Ile Phe Asp Leu Ile Lys Ala Thr Ser Pro Thr Thr Thr Asp 385 390 395 400 Val Ala Asn Leu Phe Ile Val Lys Asp Ile Ser Ala Ile Thr Asn Ser 405 410 415 Met Trp Gly Asn Asp Ala Gln Lys Ile Thr Arg Asn Arg Ile Gly Ile 420 425 430 Thr Arg Gln Gly Leu Phe Phe Asp Val Arg Glu Gly Ala Asn Trp Ala 435 440 445 Val Gln Arg Glu Gln Gln Arg Val Arg Glu Glu Arg Gln Arg Gln Gln 450 455 460 Glu Leu Ala Arg Val His Thr Arg Val Leu Glu Arg Tyr Gln Gln Leu 465 470 475 480 Gln Asp Gly Met Ser Asp Phe Lys Gly Arg Glu Thr Glu Ala Leu Ala 485 490 495 Gln Met Ala Gly Ile Lys Val Arg Phe Ala Ser Pro Leu Ala Gln Gln 500 505 510 Asp Pro Ala Thr Ser Ala Arg Val Ala Pro Met Met Val His Val Thr 515 520 525 Gly Lys Lys Gly Asp Phe Tyr Thr Leu Asp Phe Pro Ser Lys Gly Arg 530 535 540 Leu Val Ala Asp Glu Glu Tyr Ser Glu Gly Trp Tyr Val Thr Gln Val 545 550 555 560 Ala Asn Ala Thr Pro Tyr Tyr Pro Leu Asp Asp Gly Arg Ala Val Pro 565 570 575 Thr Tyr Arg Ala Tyr Ser Ala Gly Glu Pro Glu Ala Cys Gln Gln Asp 580 585 590 His Cys Ala Asp Arg Val Ser Phe Gly Ala Val Leu Ala Lys Glu Phe 595 600 605 Pro Asn Ala Gly Ile Asp Phe Ser Trp Thr Pro Glu Val Ser Gln Lys 610 615 620 Tyr Val Asn Asp Trp Asn Asn Ala Ser Ala Met Val Gln 625 630 635 98548PRTLactococcus lactis 98Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly 1 5 10 15 Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu 20 25 30 Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn 35 40 45 Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys 50 55 60 Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val 65 70 75 80 Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile 85 90 95 Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His 100 105 110 His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu 115 120 125 Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val 130 135 140 Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val 145 150 155 160 Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 165 170 175 Ser Leu Pro Leu Lys Lys Glu Asn Pro Thr Ser Asn Thr Ser Asp Gln 180 185 190 Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro 195 200 205 Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Asn Thr 210 215 220 Val Thr Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn 225 230 235 240 Phe Gly Lys Ser Ser Val Asp Glu Thr Leu Pro Ser Phe Leu Gly Ile 245 250 255 Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser 260 265 270 Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285 Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn 290 295 300 Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe 305 310 315 320 Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Gly Ile Glu Tyr Lys 325 330 335 Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala 340 345 350 Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln 355 360 365 Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala 370 375 380 Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu 385 390 395 400 Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile 405 410 415 Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu 420 425 430 Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn 435 440 445 Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu 450 455 460 Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr 465 470 475 480 Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser 485 490 495 Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala 500 505 510 Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Val Leu Ala Lys 515 520 525 Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Phe Ala Glu 530 535 540 Gln Asn Lys Ser 545 99548PRTLactococcus lactis 99Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly 1 5 10 15 Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu 20 25 30 Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn 35 40 45 Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys 50 55 60 Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val 65 70 75 80 Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile 85 90 95 Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His 100 105 110 His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Val Lys Met His Glu 115 120 125 Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val 130 135 140 Glu Ile Asp Arg Val Leu Ser Val Leu Leu Lys Glu Arg

Lys Pro Val 145 150 155 160 Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 165 170 175 Ser Leu Pro Leu Lys Lys Glu Asn Pro Asn Ser Asn Thr Ser Asp Gln 180 185 190 Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro 195 200 205 Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr 210 215 220 Val Thr Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn 225 230 235 240 Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile 245 250 255 Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser 260 265 270 Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285 Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn 290 295 300 Ile Asn Glu Gly Lys Ile Phe Ser Glu Ser Ile Gln Asn Phe Asp Phe 305 310 315 320 Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Gly Ile Glu Tyr Lys 325 330 335 Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asn Phe Val Pro Ser Asn Ala 340 345 350 Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln 355 360 365 Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala 370 375 380 Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu 385 390 395 400 Trp Gly Ser Ile Gly Phe Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile 405 410 415 Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu 420 425 430 Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn 435 440 445 Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu 450 455 460 Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr 465 470 475 480 Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Asp Arg Val Val Ser 485 490 495 Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala 500 505 510 Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Val Leu Ala Lys 515 520 525 Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Phe Ala Glu 530 535 540 Gln Asn Lys Ser 545 100547PRTLactococcus lactis 100Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly 1 5 10 15 Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu 20 25 30 Asp Gln Ile Ile Ser Arg Glu Asp Met Lys Trp Ile Gly Asn Ala Asn 35 40 45 Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys 50 55 60 Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Ile 65 70 75 80 Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile 85 90 95 Val Gly Ser Pro Thr Ser Lys Val Gln Asn Asp Gly Lys Phe Val His 100 105 110 His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu 115 120 125 Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Tyr 130 135 140 Glu Ile Asp Arg Val Leu Ser Gln Leu Leu Lys Glu Arg Lys Pro Val 145 150 155 160 Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 165 170 175 Ala Leu Ser Leu Glu Lys Glu Ser Ser Thr Thr Asn Thr Thr Glu Gln 180 185 190 Val Ile Leu Ser Lys Ile Glu Glu Ser Leu Lys Asn Ala Gln Lys Pro 195 200 205 Val Val Ile Ala Gly His Glu Val Ile Ser Phe Gly Leu Glu Lys Thr 210 215 220 Val Thr Gln Phe Val Ser Glu Thr Lys Leu Pro Ile Thr Thr Leu Asn 225 230 235 240 Phe Gly Lys Ser Ala Val Asp Glu Ser Leu Pro Ser Phe Leu Gly Ile 245 250 255 Tyr Asn Gly Lys Leu Ser Glu Ile Ser Leu Lys Asn Phe Val Glu Ser 260 265 270 Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285 Gly Ala Phe Thr His His Leu Asp Glu Asn Lys Met Ile Ser Leu Asn 290 295 300 Ile Asp Glu Gly Ile Ile Phe Asn Lys Val Val Glu Asp Phe Asp Phe 305 310 315 320 Arg Ala Val Val Ser Ser Leu Ser Glu Leu Lys Gly Ile Glu Tyr Glu 325 330 335 Gly Gln Tyr Ile Asp Lys Gln Tyr Glu Glu Phe Ile Pro Ser Ser Ala 340 345 350 Pro Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Ser Leu Thr Gln 355 360 365 Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala 370 375 380 Ser Thr Ile Phe Leu Lys Ser Asn Ser Arg Phe Ile Gly Gln Pro Leu 385 390 395 400 Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile 405 410 415 Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu 420 425 430 Gln Leu Thr Val Gln Glu Leu Gly Leu Ser Ile Arg Glu Lys Leu Asn 435 440 445 Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu 450 455 460 Ile His Gly Pro Thr Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr 465 470 475 480 Ser Lys Leu Pro Glu Thr Phe Gly Ala Thr Glu Asp Arg Val Val Ser 485 490 495 Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala 500 505 510 Gln Ala Asp Val Asn Arg Met Tyr Trp Ile Glu Leu Val Leu Glu Lys 515 520 525 Glu Asp Ala Pro Lys Leu Leu Lys Lys Met Gly Lys Leu Phe Ala Glu 530 535 540 Gln Asn Lys 545 101570PRTLactococcus lactis 101Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro 1 5 10 15 Arg Gly Ser His Met Ala Ser Met Tyr Thr Val Gly Asp Tyr Leu Leu 20 25 30 Asp Arg Leu His Glu Leu Gly Ile Glu Glu Ile Phe Gly Val Pro Gly 35 40 45 Asp Tyr Asn Leu Gln Phe Leu Asp Gln Ile Ile Ser Arg Glu Asp Met 50 55 60 Lys Trp Ile Gly Asn Ala Asn Glu Leu Asn Ala Ser Tyr Met Ala Asp 65 70 75 80 Gly Tyr Ala Arg Thr Lys Lys Ala Ala Ala Phe Leu Thr Thr Phe Gly 85 90 95 Val Gly Glu Leu Ser Ala Ile Asn Gly Leu Ala Gly Ser Tyr Ala Glu 100 105 110 Asn Leu Pro Val Val Glu Ile Val Gly Ser Pro Thr Ser Lys Val Gln 115 120 125 Asn Asp Gly Lys Phe Val His His Thr Leu Ala Asp Gly Asp Phe Lys 130 135 140 His Phe Met Lys Met His Glu Pro Val Thr Ala Ala Arg Thr Leu Leu 145 150 155 160 Thr Ala Glu Asn Ala Thr Tyr Glu Ile Asp Arg Val Leu Ser Gln Leu 165 170 175 Leu Lys Glu Arg Lys Pro Val Tyr Ile Asn Leu Pro Val Asp Val Ala 180 185 190 Ala Ala Lys Ala Glu Lys Pro Ala Leu Ser Leu Glu Lys Glu Ser Ser 195 200 205 Thr Thr Asn Thr Thr Glu Gln Val Ile Leu Ser Lys Ile Glu Glu Ser 210 215 220 Leu Lys Asn Ala Gln Lys Pro Val Val Ile Ala Gly His Glu Val Ile 225 230 235 240 Ser Phe Gly Leu Glu Lys Thr Val Thr Gln Phe Val Ser Glu Thr Lys 245 250 255 Leu Pro Ile Thr Thr Leu Asn Phe Gly Lys Ser Ala Val Asp Glu Ser 260 265 270 Leu Pro Ser Phe Leu Gly Ile Tyr Asn Gly Lys Leu Ser Glu Ile Ser 275 280 285 Leu Lys Asn Phe Val Glu Ser Ala Asp Phe Ile Leu Met Leu Gly Val 290 295 300 Lys Leu Thr Asp Ser Ser Thr Gly Ala Phe Thr His His Leu Asp Glu 305 310 315 320 Asn Lys Met Ile Ser Leu Asn Ile Asp Glu Gly Ile Ile Phe Asn Lys 325 330 335 Val Val Glu Asp Phe Asp Phe Arg Ala Val Val Ser Ser Leu Ser Glu 340 345 350 Leu Lys Gly Ile Glu Tyr Glu Gly Gln Tyr Ile Asp Lys Gln Tyr Glu 355 360 365 Glu Phe Ile Pro Ser Ser Ala Pro Leu Ser Gln Asp Arg Leu Trp Gln 370 375 380 Ala Val Glu Ser Leu Thr Gln Ser Asn Glu Thr Ile Val Ala Glu Gln 385 390 395 400 Gly Thr Ser Phe Phe Gly Ala Ser Thr Ile Phe Leu Lys Ser Asn Ser 405 410 415 Arg Phe Ile Gly Gln Pro Leu Trp Gly Ser Ile Gly Tyr Thr Phe Pro 420 425 430 Ala Ala Leu Gly Ser Gln Ile Ala Asp Lys Glu Ser Arg His Leu Leu 435 440 445 Phe Ile Gly Asp Gly Ser Leu Gln Leu Thr Val Gln Glu Leu Gly Leu 450 455 460 Ser Ile Arg Glu Lys Leu Asn Pro Ile Cys Phe Ile Ile Asn Asn Asp 465 470 475 480 Gly Tyr Thr Val Glu Arg Glu Ile His Gly Pro Thr Gln Ser Tyr Asn 485 490 495 Asp Ile Pro Met Trp Asn Tyr Ser Lys Leu Pro Glu Thr Phe Gly Ala 500 505 510 Thr Glu Asp Arg Val Val Ser Lys Ile Val Arg Thr Glu Asn Glu Phe 515 520 525 Val Ser Val Met Lys Glu Ala Gln Ala Asp Val Asn Arg Met Tyr Trp 530 535 540 Ile Glu Leu Val Leu Glu Lys Glu Asp Ala Pro Lys Leu Leu Lys Lys 545 550 555 560 Met Gly Lys Leu Phe Ala Glu Gln Asn Lys 565 570 102457PRTLactococcus lactis 102Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly 1 5 10 15 Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu 20 25 30 Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn 35 40 45 Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys 50 55 60 Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val 65 70 75 80 Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile 85 90 95 Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His 100 105 110 His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu 115 120 125 Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val 130 135 140 Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val 145 150 155 160 Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 165 170 175 Ser Leu Pro Leu Lys Lys Glu Asn Pro Thr Ser Asn Thr Ser Asp Gln 180 185 190 Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro 195 200 205 Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr 210 215 220 Val Thr Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn 225 230 235 240 Phe Gly Lys Ser Ser Val Asp Glu Thr Leu Pro Ser Phe Leu Gly Ile 245 250 255 Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser 260 265 270 Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285 Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn 290 295 300 Ile Asn Glu Gly Lys Ile Phe Asn Glu Arg Ile Gln Asn Phe Asp Phe 305 310 315 320 Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Gly Ile Glu Tyr Lys 325 330 335 Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala 340 345 350 Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln 355 360 365 Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala 370 375 380 Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu 385 390 395 400 Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile 405 410 415 Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu 420 425 430 Gln Leu Thr Val Gln Glu Arg Lys Leu Gln Val Gln Val Ser Gln Pro 435 440 445 Ser Ser Ser His Met Asn Ser Tyr Ser 450 455 103387PRTEscherichia coli 103Met Asn Asn Phe Asn Leu His Thr Pro Thr Arg Ile Leu Phe Gly Lys 1 5 10 15 Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val 20 25 30 Leu Ile Thr Tyr Gly Gly Gly Ser Val Lys Lys Thr Gly Val Leu Asp 35 40 45 Gln Val Leu Asp Ala Leu Lys Gly Met Asp Val Leu Glu Phe Gly Gly 50 55 60 Ile Glu Pro Asn Pro Ala Tyr Glu Thr Leu Met Asn Ala Val Lys Leu 65 70 75 80 Val Arg Glu Gln Lys Val Thr Phe Leu Leu Ala Val Gly Gly Gly Ser 85 90 95 Val Leu Asp Gly Thr Lys Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu 100 105 110 Asn Ile Asp Pro Trp His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115 120 125 Ser Ala Ile Pro Met Gly Cys Val Leu Thr Leu Pro Ala Thr Gly Ser 130 135 140 Glu Ser Asn Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys 145 150 155 160 Gln Ala Phe His Ser Ala His Val Gln Pro Val Phe Ala Val Leu Asp 165 170 175 Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val Ala Asn Gly Val 180 185 190 Val Asp Ala Phe Val His Thr Val Glu Gln Tyr Val Thr Lys Pro Val 195 200 205 Asp Ala Lys Ile Gln Asp Arg Phe Ala Glu Gly Ile Leu Leu Thr Leu 210 215 220 Ile Glu Asp Gly Pro Lys Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val 225 230 235 240 Arg Ala Asn Val Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245 250 255 Gly Ala Gly Val Pro Gln Asp Trp Ala Thr His Met Leu Gly His Glu 260 265 270 Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val 275 280 285 Leu Pro Ala Leu Trp Asn Glu Lys Arg Asp Thr Lys Arg Ala Lys Leu 290 295 300 Leu Gln Tyr Ala Glu Arg Val Trp Asn Ile Thr Glu Gly Ser Asp Asp 305 310 315 320 Glu Arg Ile Asp

Ala Ala Ile Ala Ala Thr Arg Asn Phe Phe Glu Gln 325 330 335 Leu Gly Val Pro Thr His Leu Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345 350 Ile Pro Ala Leu Leu Lys Lys Leu Glu Glu His Gly Met Thr Gln Leu 355 360 365 Gly Glu Asn His Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370 375 380 Ala Ala Arg 385 104387PRTEscherichia coli 104Met Asn Asn Phe Asn Leu His Thr Pro Thr Arg Ile Leu Phe Gly Lys 1 5 10 15 Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val 20 25 30 Leu Ile Thr Tyr Gly Gly Gly Ser Val Lys Lys Thr Gly Val Leu Asp 35 40 45 Gln Val Leu Asp Ala Leu Lys Gly Met Asp Val Leu Glu Phe Gly Gly 50 55 60 Ile Glu Pro Asn Pro Ala Tyr Glu Thr Leu Met Asn Ala Val Lys Leu 65 70 75 80 Val Arg Glu Gln Lys Val Thr Phe Leu Leu Ala Val Gly Gly Gly Ser 85 90 95 Val Leu Asp Gly Thr Lys Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu 100 105 110 Asn Ile Asp Pro Trp His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115 120 125 Ser Ala Ile Pro Met Gly Cys Val Leu Thr Leu Pro Ala Thr Gly Ser 130 135 140 Glu Ser Asn Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys 145 150 155 160 Gln Ala Phe His Ser Ala His Val Gln Pro Val Phe Ala Val Leu Asp 165 170 175 Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val Ala Asn Gly Val 180 185 190 Val Asp Ala Phe Val His Thr Val Glu Gln Tyr Val Thr Lys Pro Val 195 200 205 Asp Ala Lys Ile Gln Asp Arg Phe Ala Glu Gly Ile Leu Leu Thr Leu 210 215 220 Ile Glu Asp Gly Pro Lys Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val 225 230 235 240 Arg Ala Asn Val Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245 250 255 Gly Ala Gly Val Pro Gln Asp Trp Ala Thr His Met Leu Gly His Glu 260 265 270 Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val 275 280 285 Leu Pro Ala Leu Trp Asn Glu Lys Arg Asp Thr Lys Arg Ala Lys Leu 290 295 300 Leu Gln Tyr Ala Glu Arg Ile Trp Asn Ile Thr Glu Gly Ser Asp Asp 305 310 315 320 Glu Arg Ile Asp Ala Ala Ile Ala Ala Thr Arg Asn Phe Phe Glu Gln 325 330 335 Leu Gly Val Pro Thr His Leu Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345 350 Ile Pro Ala Leu Leu Lys Lys Leu Glu Glu His Gly Met Thr Gln Leu 355 360 365 Gly Glu Asn His Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370 375 380 Ala Ala Arg 385 105387PRTEscherichia coli 105Met Asn Asn Phe Asn Leu His Thr Pro Thr Arg Ile Leu Phe Gly Lys 1 5 10 15 Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val 20 25 30 Leu Ile Thr Tyr Gly Gly Gly Ser Val Lys Lys Thr Gly Val Leu Asp 35 40 45 Gln Val Leu Asn Ala Leu Lys Gly Met Asp Val Leu Glu Phe Gly Gly 50 55 60 Ile Glu Pro Asn Pro Ala Tyr Glu Thr Leu Met Asn Ala Val Lys Leu 65 70 75 80 Val Arg Glu Gln Lys Val Thr Phe Leu Leu Ala Val Gly Gly Gly Ser 85 90 95 Val Leu Asp Gly Thr Lys Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu 100 105 110 Asn Ile Asp Pro Trp His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115 120 125 Ser Ala Ile Pro Met Gly Cys Val Leu Thr Leu Pro Ala Thr Gly Ser 130 135 140 Glu Ser Asn Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys 145 150 155 160 Gln Ala Phe His Ser Ala His Val Gln Pro Val Phe Ala Val Leu Asp 165 170 175 Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val Ala Asn Gly Val 180 185 190 Val Asp Ala Phe Val His Thr Val Glu Gln Tyr Val Thr Lys Pro Val 195 200 205 Asp Ala Lys Ile Gln Asp Arg Phe Ala Glu Gly Ile Leu Leu Thr Leu 210 215 220 Ile Glu Asp Gly Pro Lys Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val 225 230 235 240 Arg Ala Asn Val Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245 250 255 Gly Ala Gly Val Pro Gln Asp Trp Ala Thr His Met Leu Gly His Glu 260 265 270 Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val 275 280 285 Leu Pro Ala Leu Trp Asn Glu Lys Arg Asp Thr Lys Arg Ala Lys Leu 290 295 300 Leu Gln Tyr Ala Glu Arg Val Trp Asn Ile Thr Glu Gly Ser Asp Asp 305 310 315 320 Glu Arg Ile Asp Ala Ala Ile Ala Ala Thr Arg Asn Phe Phe Glu Gln 325 330 335 Leu Gly Val Pro Thr His Leu Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345 350 Ile Pro Ala Leu Leu Lys Lys Leu Glu Glu His Gly Met Thr Gln Leu 355 360 365 Gly Glu Asn His Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370 375 380 Ala Ala Arg 385 106387PRTEscherichia coli 106Met Asn Asn Phe Asn Leu His Thr Pro Thr Arg Ile Leu Phe Gly Lys 1 5 10 15 Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val 20 25 30 Leu Ile Thr Tyr Gly Gly Gly Ser Val Lys Lys Thr Gly Val Leu Asp 35 40 45 Gln Val Leu Asp Ala Leu Lys Gly Met Asp Val Leu Glu Phe Gly Gly 50 55 60 Ile Glu Pro Asn Pro Ala Tyr Glu Thr Leu Met Asn Ala Val Lys Leu 65 70 75 80 Val Arg Glu Gln Lys Val Thr Phe Leu Leu Ala Val Gly Gly Gly Ser 85 90 95 Val Leu Asp Gly Thr Lys Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu 100 105 110 Asn Ile Asp Pro Trp His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115 120 125 Ser Ala Ile Pro Met Gly Cys Val Leu Thr Leu Pro Ala Thr Gly Ser 130 135 140 Glu Ser Asn Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys 145 150 155 160 Gln Ala Phe His Ser Ala His Val Gln Pro Val Phe Ala Val Leu Asp 165 170 175 Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val Ala Asn Gly Val 180 185 190 Val Asp Ala Phe Val His Thr Val Glu Gln Tyr Val Thr Lys Pro Val 195 200 205 Asp Ala Lys Ile Gln Asp Arg Phe Ala Glu Gly Ile Leu Leu Thr Leu 210 215 220 Ile Glu Asp Gly Pro Lys Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val 225 230 235 240 Arg Ala Asn Val Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245 250 255 Gly Ala Gly Val Pro Gln Asp Trp Ala Thr His Met Leu Gly His Glu 260 265 270 Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val 275 280 285 Leu Pro Ala Leu Trp Asn Glu Lys Arg Glu Thr Lys Arg Ala Lys Leu 290 295 300 Leu Gln Tyr Ala Glu Arg Val Trp Asn Ile Thr Glu Gly Ser Asp Asp 305 310 315 320 Glu Arg Ile Asp Ala Ala Ile Ala Ala Thr Arg Asn Phe Phe Glu Gln 325 330 335 Leu Gly Val Pro Thr His Leu Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345 350 Ile Pro Ala Leu Leu Lys Lys Leu Glu Glu His Gly Met Thr Gln Leu 355 360 365 Gly Glu Asn His Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370 375 380 Ala Ala Arg 385 107387PRTEscherichia coli 107Met Asn Asn Phe Asn Leu His Thr Pro Thr Arg Ile Leu Phe Gly Lys 1 5 10 15 Gly Ala Ile Ala Gly Leu Arg Glu Gln Ile Pro His Asp Ala Arg Val 20 25 30 Leu Ile Thr Tyr Gly Gly Gly Ser Val Lys Lys Thr Gly Val Leu Asp 35 40 45 Gln Val Leu Asp Ala Leu Lys Gly Met Asp Val Leu Glu Phe Gly Gly 50 55 60 Ile Glu Pro Asn Pro Ala Tyr Glu Thr Leu Met Asn Ala Val Lys Leu 65 70 75 80 Val Arg Glu Gln Lys Val Thr Phe Leu Leu Ala Val Gly Gly Gly Ser 85 90 95 Val Leu Asp Gly Thr Lys Phe Ile Ala Ala Ala Ala Asn Tyr Pro Glu 100 105 110 Asn Ile Asp Pro Trp His Ile Leu Gln Thr Gly Gly Lys Glu Ile Lys 115 120 125 Ser Ala Ile Pro Met Gly Cys Val Leu Thr Leu Pro Ala Thr Gly Ser 130 135 140 Glu Ser Asn Ala Gly Ala Val Ile Ser Arg Lys Thr Thr Gly Asp Lys 145 150 155 160 Gln Ala Phe His Ser Ala His Val Gln Pro Val Phe Ala Val Leu Asp 165 170 175 Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Gln Val Ala Asn Gly Val 180 185 190 Val Asp Ala Phe Val His Thr Val Glu Gln Tyr Val Thr Lys Pro Val 195 200 205 Asp Ala Lys Ile Gln Asp Arg Phe Ala Glu Gly Ile Leu Leu Thr Leu 210 215 220 Ile Glu Asp Gly Pro Lys Ala Leu Lys Glu Pro Glu Asn Tyr Asp Val 225 230 235 240 Arg Ala Asn Val Met Trp Ala Ala Thr Gln Ala Leu Asn Gly Leu Ile 245 250 255 Gly Ala Gly Val Pro Gln Asp Trp Ala Thr His Met Leu Gly His Lys 260 265 270 Leu Thr Ala Met His Gly Leu Asp His Ala Gln Thr Leu Ala Ile Val 275 280 285 Leu Pro Ala Leu Trp Asn Glu Lys Arg Asp Thr Lys Arg Ala Lys Leu 290 295 300 Leu Gln Tyr Ala Glu Arg Val Trp Asn Ile Thr Glu Gly Ser Asp Asp 305 310 315 320 Glu Arg Ile Asp Ala Ala Ile Ala Ala Thr Arg Asn Phe Phe Glu Gln 325 330 335 Leu Gly Val Pro Thr His Leu Ser Asp Tyr Gly Leu Asp Gly Ser Ser 340 345 350 Ile Pro Ala Leu Leu Lys Lys Leu Glu Glu His Gly Met Thr Gln Leu 355 360 365 Gly Glu Asn His Asp Ile Thr Leu Asp Val Ser Arg Arg Ile Tyr Glu 370 375 380 Ala Ala Arg 385 10838DNAartificialsynthetic oligonucleotide primer 108gggcccggta ccatgtcctc agccatctat cccagcct 3810957DNAartificialsynthetic oligonucleotide primer 109gggcccgctc agcaagcttg ctagcggatc cttaacgcca gccggcgtcg atccagt 5711052DNAartificialsynthetic oligonucleotide primer 110gggcccggat ccaggagaaa ttaactatga ccgctcaagt cacttgcgta tg 5211144DNAartificialsynthetic oligonucleotide primer 111gggcccaagc ttgctagctt agacaaggcg gacctcatgc tggg 4411252DNAartificialsynthetic oligonucleotide primer 112gggcccgcta gcaggagaaa ttaactatga ggtccgcctt gtctaaccgc ac 5211338DNAartificialsynthetic oligonucleotide primer 113gggcccaagc ttttagtggt tgtggcgggg cagcttgg 3811452DNAartificialsynthetic oligonucleotide primer 114gggcccaagc ttaggagaaa ttaactatgg tttgtcggcg gcttctagca tg 5211559DNAartificialsynthetic oligonucleotide primer 115gcgcagctgg cgttgttgtc cttggccttt ctgagcagca gggccgaacg accttcgaa 5911639DNAartificialsynthetic oligonucleotide primer 116gggcccgctc agcttagagg aggccgcggc cggccaggt 3911760DNAartificialsynthetic oligonucleotide primer 117actgaccgaa ttcattaaag aggagaaagg taccatgtat acagtaggag attacctatt 6011826DNAartificialsynthetic oligonucleotide primer 118ttatgattta ttttgttcag caaata 2611960DNAartificialsynthetic oligonucleotide primer 119ctgaacaaaa taaatcataa aggagaaatt aactatgaac aactttaatc tgcacacccc 6012060DNAartificialsynthetic oligonucleotide primer 120actgaccgaa ttcattaaag aggagaaagg taccatggct tcggtacacg gcaccacata 6012126DNAartificialsynthetic oligonucleotide primer 121ttacttcacc gggcttacgg tgctta 2612238DNAartificialsynthetic oligonucleotide primer 122gggcccggta ccatgaccga caccctgcgc cattacat 3812338DNAartificialsynthetic oligonucleotide primer 123gggccctcta gattacgacc acgagtagga ggttttgg 3812460DNAartificialsynthetic oligonucleotide primer 124attgtgagcg gataacaatt tcacacagga aacagctatg accatgatta cgccaagctt 6012560DNAartificialsynthetic oligonucleotide primer 125cagctatgac catgattacg ccaagcttgg tacctcgtag gaacaatttc gggcccctgc 6012660DNAartificialsynthetic oligonucleotide primer 126cttcaggctg ggatagatgg ctgaggacat tttttgatta aaattaaaaa aactttttgt 6012760DNAartificialsynthetic oligonucleotide primer 127acaaaaagtt tttttaattt taatcaaaaa atgtcctcag ccatctatcc cagcctgaag 6012860DNAartificialsynthetic oligonucleotide primer 128tgatcatgaa ttaataaaag tgttcgcaaa ttaacgccag ccggcgtcga tccagtattc 6012960DNAartificialsynthetic oligonucleotide primer 129gaatactgga tcgacgccgg ctggcgttaa tttgcgaaca cttttattaa ttcatgatca 6013060DNAartificialsynthetic oligonucleotide primer 130actcacgagt aattcttgca aatgcctcct aggagacact ttttgaagcg ggatacagaa 6013160DNAartificialsynthetic oligonucleotide primer 131ttctgtatcc cgcttcaaaa agtgtctcct aggaggcatt tgcaagaatt actcgtgagt 6013260DNAartificialsynthetic oligonucleotide primer 132atcccatacg caagtgactt gagcggtcat tgttttatat ttgttgtaaa aagtagataa 6013360DNAartificialsynthetic oligonucleotide primer 133ttatctactt tttacaacaa atataaaaca atgaccgctc aagtcacttg cgtatgggat 6013460DNAartificialsynthetic oligonucleotide primer 134attgatctat cgatttcaat tcaattcaat ttagacaagg cggacctcat gctggggttg 6013560DNAartificialsynthetic oligonucleotide primer 135caaccccagc atgaggtccg ccttgtctaa attgaattga attgaaatcg atagatcaat 6013660DNAartificialsynthetic oligonucleotide primer 136ccgatgtatg ggtttggttg ccagaagctg agcttggagc aggaagaata cactatactg 6013760DNAartificialsynthetic oligonucleotide primer 137cagtatagtg tattcttcct gctccaagct cagcttctgg caaccaaacc catacatcgg 6013860DNAartificialsynthetic oligonucleotide primer 138gggcgtgcgg ttagacaagg cggacctcat tgtatatgag atagttgatt gtatgcttgg 6013960DNAartificialsynthetic oligonucleotide primer 139ccaagcatac aatcaactat ctcatataca atgaggtccg ccttgtctaa ccgcacgccc 6014060DNAartificialsynthetic oligonucleotide primer 140aataaaaatc ataaatcata agaaattcgc ttagtggttg tggcggggca gcttggccgc 6014160DNAartificialsynthetic oligonucleotide primer 141gcggccaagc tgccccgcca caaccactaa gcgaatttct tatgatttat gatttttatt 6014260DNAartificialsynthetic oligonucleotide primer 142gaaggtatgg gtgcagtgtg cttatctact agttgtggaa gaacgattac aacaggtgtt 6014360DNAartificialsynthetic oligonucleotide primer 143aacacctgtt gtaatcgttc ttccacaact agtagataag cacactgcac ccataccttc 6014460DNAartificialsynthetic oligonucleotide primer 144ggtccatgct agaagccgcc gacaaaccat tttgattgat ttgactgtgt tattttgcgt

6014560DNAartificialsynthetic oligonucleotide primer 145acgcaaaata acacagtcaa atcaatcaaa atggtttgtc ggcggcttct agcatggacc 6014660DNAartificialsynthetic oligonucleotide primer 146actttaacta ataattagag attaaatcgc ttagaggagg ccgcggccgg ccaggttgcg 6014760DNAartificialsynthetic oligonucleotide primer 147cgcaacctgg ccggccgcgg cctcctctaa gcgatttaat ctctaattat tagttaaagt 6014860DNAartificialsynthetic oligonucleotide primer 148acgttgtaaa acgacggcca gtgaattctc tagagcttgt cttgagcaat tgcagagtcg 6014960DNAartificialsynthetic oligonucleotide primer 149agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc cagtgaattc 6015060DNAartificialsynthetic oligonucleotide primer 150ctaataggta atctcctact gtatacatgg atcctttttg attaaaatta aaaaaacttt 6015160DNAartificialsynthetic oligonucleotide primer 151aaagtttttt taattttaat caaaaaggat ccatgtatac agtaggagat tacctattag 6015260DNAartificialsynthetic oligonucleotide primer 152tcatgaatta ataaaagtgt tcgcaaaggt accttatgat ttattttgtt cagcaaatag 6015360DNAartificialsynthetic oligonucleotide primer 153ctatttgctg aacaaaataa atcataaggt acctttgcga acacttttat taattcatga 6015460DNAartificialsynthetic oligonucleotide primer 154cttactcacg agtaattctt gcaaatgcct agacactttt tgaagcggga tacagaaaaa 6015560DNAartificialsynthetic oligonucleotide primer 155tttttctgta tcccgcttca aaaagtgtct aggcatttgc aagaattact cgtgagtaag 6015660DNAartificialsynthetic oligonucleotide primer 156tggggtgtgc agattaaagt tgttcattct agatgtttta tatttgttgt aaaaagtaga 6015760DNAartificialsynthetic oligonucleotide primer 157tctacttttt acaacaaata taaaacatct agaatgaaca actttaatct gcacacccca 6015860DNAartificialsynthetic oligonucleotide primer 158gatctatcga tttcaattca attcaatctc gagttagcgg gcggcttcgt atatacggcg 6015960DNAartificialsynthetic oligonucleotide primer 159cgccgtatat acgaagccgc ccgctaactc gagattgaat tgaattgaaa tcgatagatc 6016060DNAartificialsynthetic oligonucleotide primer 160gtcacgacgt tgtaaaacga cggccagtga attctgagct tggagcagga agaatacact 60

* * * * *

File A Patent Application

  • Protect your idea -- Don't let someone else file first. Learn more.

  • 3 Easy Steps -- Complete Form, application Review, and File. See our process.

  • Attorney Review -- Have your application reviewed by a Patent Attorney. See what's included.